20-HYDROXYECDYSONE-DERIVED PRODUCTS AND THEIR USE IN THE PREPARATION OF MEDICAMENTS

专利摘要:
The present invention relates to products derived from 20-hydroxyecdysone (20E) and their therapeutic use, in particular for improving muscle quality in mammals. More particularly, the invention makes it possible to improve the muscular quality of sarcopenic mammals and to treat and / or prevent sarcopenia and in particular sarcopenic obesity, its complications and / or associated pathologies such as loss of strength, muscle mass and mobility. The invention also makes it possible to improve the muscular quality in obese mammals and to treat and / or prevent obesity and its complications and / or associated pathologies, advantageously type 2 diabetes and the metabolic syndrome.
公开号:FR3021318A1
申请号:FR1454538
申请日:2014-05-20
公开日:2015-11-27
发明作者:Sophie Raynal；Waly Dioh；Stanislas Veillet；Rene Lafont；Franck Lepifre；Jean-Denis Durand
申请人:METABRAIN RES；Universite Pierre et Marie Curie Paris 6；Institut Biophytis SAS；
IPC主号:

专利说明:

[0001] FIELD OF THE INVENTION The present invention relates to products derived from 20-hydroxyecdysone (20E) and to their therapeutic use, in particular for the treatment of psoriasis. improvement of muscle quality in mammals.
[0002] More particularly, the invention makes it possible to improve the muscular quality of sarcopenic mammals and to treat and / or prevent sarcopenia and in particular sarcopenic obesity, its complications and / or associated pathologies such as loss of strength, muscle mass and mobility.
[0003] The invention also makes it possible to improve the muscular quality in obese mammals and to treat and / or prevent obesity and its complications and / or associated pathologies, advantageously type 2 diabetes and the metabolic syndrome.
[0004] STATE OF THE ART Muscular atrophy can result from several different causes: undernutrition, non-use of muscles (eg immobilization following a fracture), cancer or other serious illness (heart or kidney failure) inducing cachexia, or resulting naturally from aging of individuals (sarcopenia). This atrophy may result from a reduction in proteosynthesis or / and an increase in proteolysis and, depending on the case, may be accompanied by fibrosis or / and infiltration by adipose tissue.
[0005] The identification of factors and mechanisms controlling muscle proteosynthesis and proteolysis is therefore a prerequisite for designing appropriate treatments for these pathologies. Figure 1, part of the state of the art, shows the main pathways of proteosynthesis and proteolysis in muscles (recomposed from Zhao et al., 2008 and Little et al., 2009). Muscle proteosynthesis is essential, and is essentially controlled at the translational level. It obviously requires an adequate nutritional intake of amino acids. It is stimulated by physical activity and regulated by many factors, first and foremost IGF-1 and androgens (Little et al., 2009). Table 1: Factors and Molecules Affecting Proteosynthesis and Proteolysis in Muscle Factor Proteosynthesis Proteolysis Stimulation Inhibition Stimulation Inhibition Exercise + (+) Denervation - Fasting, Anorexia - + Amino Acids + - Insulin + - GH / IGF-1 + - FGF + + Vitamin D + Adrenaline + - Acetylcholine - Oxytocin + Apeline + Testosterone + - Oestradiol + - Triiodothyronine (T3) + Myostatin - + TGFI3 - + Follistatin - Angiotensin II - + Agiotensin - (1-7) - Glucocorticoids - + PIF - + 302 1 3 1 8 3 IL-1I3 + IL-6H + TNF-α, IFN-γ + Anti-inflammatory Proteolysis of myofibrils occurs via the proteasome, while mitochondria are destroyed by autophagy (Zhao et al., 2008). Apoptosis mechanisms of the satellite cells are also described (Murphy et al., 2010). Myostatin, produced autocrine by the muscles themselves, is a particularly important factor, as it acts both by stimulating proteolysis and inhibiting proteosynthesis. It also stimulates fibrosis (Li et al., 2008). Aging is accompanied by a modification of the various regulatory factors (Walston et al., 2012): physical activity is often reduced, protein / vitamin nutrition may be insufficient and, following meals, amino acid levels circulants, whose increase is necessary to stimulate proteosynthesis, show a reduced increase which may be due to splanchnic sequestration (Boirie et al., 1997). In addition, aging is accompanied by significant hormonal changes: in particular, an increase in myostatin (Léger et al., 2008), a reduction of androgens (Seidman, 2007), growth hormone (Macell et al. al., 2001; Sattler, 2013), as well as an increase in markers of inflammation (IL-6, TNF-a ... Schaap et al., 2009, Verghese et al., 2011). These various modifications are unfavorable for proteosynthesis, while they promote proteolysis, hence the progressive reduction of muscle size (sarcopenia). They also cause a change in the distribution of muscle fiber types at the expense of fast fibers, which results in a decrease in muscle strength (dynapenia). Finally, there is the development of connective tissue within the muscles (fibrosis).
[0006] In a context of obesity, the situation is aggravated for several complementary reasons: the fatty infiltration of the muscles aggravates the inflammatory context, the insulin resistance reduces the effect of the IGF-1 on the proteosynthesis, besides the Mobility is reduced by being overweight (Stenholm et al., 2009). Figure 2, part of the state of the art, illustrates the worsening of sarcopenia in a context of obesity (after Quillot et al., 2013). In all cases, in the absence of treatment, sarcopenia is a process that can only worsen, until the total loss of mobility. Sarcopenia, however, is not the only process leading to atrophy of skeletal muscles. Atrophy also occurs during immobilization (eg following a fracture), during prolonged fasting (or dieting), or during serious pathologies (eg cancers, AIDS) that cause cachexia . We can also mention the various muscular dystrophies of genetic origin. These different situations have a number of characteristics that are common with sarcopenia, but with a respective weight different from the triggering factors (Tisdale 2007, Saini et al., 2009).
[0007] Possible treatments known Various methods of prevention / treatment of sarcopenia were therefore considered and tested. It is primarily physical exercise, the effectiveness of which is established (Bonnefoy et al, 2000, Bonnefoy, 2008, Ryan et al., 2013). Thus, following exercises over a period of 8 weeks, increases in muscle strength of 180% and muscle mass of 11% were observed (Fiatarone et al., 1990). However, optimal efficiency would require several hours of physical exercise a day, which is difficult to envisage over long periods. An increased supply of substrates for protein synthesis, whether by giving proteins with rapid digestion, and according to an optimized chronology (Coeffier et al., 2009; Aussel et al., 2013), as well as that supplementation with certain amino acids or their metabolites (leucine, HMB [13-hydroxy-13-methylbutyrate], citrulline, ornithine) may increase muscle proteosynthesis (Li & Heber, 2011). Various pharmaceutical treatments are aimed at correcting changes in the hormonal context related to aging (Crenn, 2013). They include: sex hormones such as testosterone (White et al., 2013) or variants thereof, Selective Androgen Receptor Modulators (MRSA), or nonsexual hormones such as growth hormone (Liu et al., 2003) and IGF-1, ghrelin or progranulin, or even vitamin D 15 - myostatin inhibitors (antibodies directed against the molecule or its receptor, or precursor peptide of myostatin) (Murphy et al., 2010). Han & Mitch, 2011) - molecules targeting the renin-angiotensin system such as ACE inhibitors or angiotensin 1-7 (Dalla Libera et al., 2001; Shiuchi et al., 2004; Kalupahana & Moustaid- Moussa 2012, Allen et al., 2013) - 13-adrenergic receptor agonists (Ryall et al., 2004, 2007) - various natural substances, or even more complex extracts of plant origin (eg isoflavones: Aubertin-Leheudre et al., 2007, Olive oil extract: Pierno et al., 2014, Resveratrol: Shadfar and al., 20011, Bennett et al., 2013). 302 1 3 1 8 6 The great diversity of these treatments shows the difficulty of treating a multifactorial pathology, whose triggering factors are not fully identified. In addition, several candidate molecules have side effects (eg, sex hormones, MRSA, or 3-agonists), or have only been studied in animal models. All these factors explain the lack of drugs available on the market. To date, research has focused more particularly on myostatin, by inhibiting its action with, for example, anti-myostatin antibodies or anti-receptor antibodies (Dumonceaux et al., 2010; Greenberg 2012; Sakuma & Yamaguchi 2012; Arounleut et al., 2013; Buehring & Binkley, 2013; Collins-Hooper et al., 2014; White & LeBrasseur, 2014). Phytoecdysones, and more particularly 20-hydroxyecdysone (20E), have been the subject of numerous pharmacological studies, which began in Japan and then in Uzbekistan, and subsequently developed in various other countries. These studies have highlighted the antidiabetic and anabolic properties of this molecule. Its stimulatory effects on protein synthesis in muscle are observed in rats in vivo (Syrov 2000, Toth et al., 2008, Lawrence 2012) and on C2C12 murine myotubes in vitro (Gorelick-Feldman et al. 2008). This translational effect involves the phosphorylation of the ribosomal protein p70S6K at the end of a cascade involving the Akt / PkB protein kinase, a pathway also used by the IGF- 1 to stimulate proteosynthesis. Using the same C2C12 cells, Zubeldia et al. (2012) have also shown that an extract of Ajuga turkestanica enriched in phytoecdysones (20-hydroxyecdysone and turkesterone) inhibits the transcription of myostatin and caspase 3 (a protein involved in apoptosis processes).
[0008] In addition, 20-hydroxyecdysone has antifibrotic properties, which have not been demonstrated in muscles, but in the kidneys, where the mechanisms of fibrosis proceed in a very similar way (Hung et al., 2012). They are thus opposed to the effects of TGFI3, a protein close to myostatin, and in particular to the stimulation of Smad 2.3 that this substance causes. We can therefore think that 20-hydroxyecdysone could have similar effects on the muscles (or the heart). Finally, 20-hydroxyecdysone reduces fat mass accumulation in mice fed a fat-enriched diet (Kizelsztein et al., 2009, Foucault et al., 2012) or ovariectomized rats, a model of menopause (Seidlova -Wuttke et al., 2010). Some of the effects described above in animal models have been found in clinical studies, still few. Thus, 20-hydroxyecdysone increases physical capacity (Azizov et al., 1995; Gadhzieva et al., 1995) and muscle mass (Simakin et al., 1988) and causes abdominal fat loss in obese volunteers and overweight (Wuttke et al., 2013; Foucault et al., 2014; PCT patent application WO 2013/068704). If we group these different data, we find that 20-hydroxyecdysone stimulates muscle protein synthesis, inhibits proteolysis (myostatin) and apoptosis, as well as fibrosis, and limits / reduces adiposity. All these effects seem to indicate that this molecule represents an interesting candidate to treat / prevent sarcopenia as well as sarcopenic obesity.
[0009] DESCRIPTION OF THE INVENTION The inventors have created innovative molecules derived from 20-hydroxyecdysone (20E) by hemisynthesis. They also discovered that these 20E-derived products have effects greater than those of 20E for myostatin inhibition and the stimulation of protein synthesis by phosphorylation of S6K1 protein. These effects improve the quality and / or muscle strength of sarcopenic and obese sarcopenic mammals. 20E and its derivatives do not interact with the steroidal nuclear receptors of the sexual sphere (androgen and estrogen receptors). They show good chemical stability in the plasma and in microsomes. Several of them finally have improved bioavailability compared to 20-hydroxyecdysone. The invention therefore provides compounds of the following general formula (I): Q-R 1 (I) in which: X is chosen from: oxygen; an N-OR5 group, R5 then being chosen from: a hydrogen; a C1-C6 alkyl group with or without unsaturations on the chain; a group (C1-C6) CO2R6 with R6 may be a hydrogen or a group Ci-C6; a group (C1-C6) OR7, R7 being an aromatic or heteroaromatic ring mono or polysubstituted or not by an alkyl or alkoxyl group, CF3, Cl; a group (C1-C6) NR9R9, R9 and R9 being C1-C6 groups, or (C1-C6) N (C1-C6) groups or (C1-C6) N (C1-C6) groups 0R6 with R6 defined as above, NR9R9 may also be a heterocycle; and wherein: - R1 is selected from: a C1-C6 alkyl group; a group (C1-C6) W (C1-C6); a group (C1-C6) W (C1-C6) W (C1-C6); a group (C1-C6) W (C1-C6) CO2 (C1-C6); a group (C1-C6) A, A representing a heterocycle optionally substituted by a group of OH, OMe, (C1-C6), N (C1-C6), CO2 (C1-C6); with V-U being a carbon-carbon single bond and Y being a hydroxyl group or a hydrogen, or V-U being a Cyl C ethylenic bond; and, with Q selected from: a carbonyl group; a group of CHO (C1-C6) type; a group C = NOR5, R5 being defined as above; a group CHNR 2 R 3, R 2 and R 3 being chosen from: a hydrogen atom; a (C 1 -C 6) alkyl group; a group (C 1 -C 6) W (C 1 -C 6); a cycloalkyl group; a group (C1-C6) CHF2; a group (C1-C6) A with A representing a heterocycle defined as above; a group of COR4 type, R4 being chosen from: an optionally unsaturated (C1-C6) alkyl or cycloalkyl group; a heterocyclic group of type A as defined above, an aromatic or heteroaromatic group optionally substituted with a group of OH, OMe, (Ci-C6), N (C1-C6), CO2 (C1-C6), CF3, OCF3 type; , CN, CI, F; a group (C1-C6) W (C1-C6); W being a heteroatom selected from N, O and S; or, - al is selected from: a (C 1 -C 6) W (C 1 -C 6) group; a group (C1-C6) W (C1-C6) W (C1-C6); a group (Ci-C6) W (C1-C6) CO2 (C1-C6); with Q being a CHOH group; with V-U being a carbon-carbon single bond and Y being a hydroxyl group or a hydrogen, V-U may also be a Cyl C ethylenic bond; W being a heteroatom selected from N and S; or, - R1 is -CH (Me) CH (OH) (CH2) 2C (CH3) 20H; Q is a group C (Me) OH; V-U is an ethylenic bond C = C; excluding post-terone of formula (I '), deoxy-poststerone 14 of formula (I "), stachysterone B of formula (I"') and stachysterone-derivative product B of formula (I ') ""): the compounds being in the form of an enantiomer, a diastereoisomer, a hydrate, a solvate, a tautomer, a racemic mixture or a pharmaceutically acceptable salt.
[0010] A particular form of the invention uses the products of general formula (I) mentioned above in which Q represents a carbonyl group. Another particular form of the invention uses the products of the general formula (I) in which Q represents a group C = NOR5, R5 being defined as above. Another particular form of the invention uses the products of general formula (I) in which Q represents a CHNR 2 R 3 group. Another particular form of the invention uses the products of general formula (I) in which V-U is a Cyl C ethylenic linkage.
[0011] Another particular form of the invention uses the products of general formula (I) in which X is a group N-OR5, R5 being defined as above.
[0012] Another particular form of the invention uses the products of general formula (I) chosen from the following compounds: (2R, 3R) -2 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) - 2,3-Dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,2,4,5,9,11,12,16,17-decahydrocyclopenta [a] phenanthrene-17-yl] -6-methyl-heptane -2,3,6-triol 1 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,3,4 5,9,11,12,16,17-Decahydrocyclopenta [a] phenanthrene 17-yl] ethanone 1 - [(2S, 3R, 5R, 6Z, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy 6-methoxyimino-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethanone (2S, 3R) 5R, 10R, 13R, 14S, 17S) -17- (N-but-3-enoxy-C-methyl-carbonimidoyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4, 5,9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one 2-methoxy-N- (2-methoxyethyl) -N41 - [(2S, 3R, 5R, 10R) , 13R, 14S, 17S) - 2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H- cyclopenta [a] phenanthren-17-yl] eth yl] acetamide (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-17- [1- (2-methoxyethylamino) ethyl] -10,13-dimethyl-2,3, 4,5,9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2.3,14 3-Trihydroxy-10,13-dimethyl-1741- (tetratetrahydrofuran-2-ylmethylamino) ethyl] -2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene 6-one-2-ethyl-N- (2-methoxyethyl) -N41 - [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-6-one -oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] butanamide 2-methoxy-N- (tetratetrahydrofuran-2-ylmethyl) ) -N- [1 - [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo2,3,4,5,9, 11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] acetamide N- (2,2-difluoroethyl) -N11- [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydroH-cyclopenta [a ] phenanthren-17-yl] ethyl] furan-2-carboxamide (2S, 3R, 5R, 10R, 13R, 14S, 1 7S) -2,3,14-trihydroxy-1741- (2-methoxyethyl (methyl) amino) ethyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17 Decahydro-1H-cyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-17- (2-morpholinoacetyl) ) -2,3,4,5,9,11,12,15,16,17-Decahydro-1Hcyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2 , 3,14-trihydroxy-1742- (3-hydroxypyrrolidin-1-yl) acetyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H cyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-17- [2- (4-hydroxy-1-piperidyl) acetyl] 10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-174214- (2-hydroxyethyl) -1-piperidyl] acetyl] -10,13-dimethyl-2,3,4,5,9,11,12,15, 16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- [2- (3-dimethylaminopropyl (methyl) amino) acetyl] 2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1 Hcyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (2-ethylsulfanylacetyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3 4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2.3, 14-Trihydroxy-1742- (2-hydroxyethylsulfanyl) acetyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene; 6-one; ; Another particular form of the invention uses the products of general formula (I) as a medicament.
[0013] Another particular form of the invention uses the products of general formula (I) for their use in the treatment and / or prevention of sarcopenia and in particular of sarcopenic obesity, its complications and / or associated pathologies such as loss of strength, muscle mass and mobility.
[0014] Another particular form of the invention uses the products of general formula (I) for their use in the treatment and / or prevention of obesity and its complications and / or associated pathologies, advantageously type diabetes. 2 or metabolic syndrome.
[0015] BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1, which is part of the state of the art, illustrates the main pathways of proteosynthesis and proteolysis in muscles (composed according to Zhao et al., 2008 and Little et al., 2009 ). - Figure 2, part of the state of the art, illustrates the worsening of sarcopenia in a context of obesity (after Quillot et al., 2013). Detailed Description The object of the invention is to develop novel chemical compounds derived from 20-hydroxyecdysone (20E). These last molecules are new because they do not exist in the (phyto) ecdysones chemical databases. They are synthesized according to easily industrializable processes, that is to say with a minimum of synthesis steps and an optimal yield. They have effects greater than those of 20E for the inhibition of myostatin, the stimulation of proteosynthesis by the phosphorylation of the S6K1 protein. These compounds show good chemical stability in the plasma and in microsomes. They have an improved bioavailability and a defined dosage. They stimulate muscle anabolism in C2C12 cells and show an antihyperglycaemic effect. In the context of the present invention, the term "aryl group" means an aromatic ring having 5 to 8 carbon atoms or several fused aromatic rings having 5 to 14 carbon atoms. In particular, the aryl groups may be monocyclic or bicyclic groups, preferably phenyl or naphthyl. Advantageously it is a phenyl group (Ph).
[0016] In the context of the present invention, the term "heteroaryl group" means any aromatic hydrocarbon group of 3 to 9 atoms containing one or more heteroatoms, such as, for example, sulfur, nitrogen or oxygen atoms. The heteroaryl according to the present invention may consist of one or more fused rings. Examples of heteroaryl are furyl, isoxazyl, pyridyl, thiazolyl, pyrimidyl, benzimidazole, benzoxazole, benzothiazole. Advantageously, the heteroaryl group is chosen from furyl, pyridyl and thiazolyl groups. Advantageously it is the furyl group.
[0017] In the context of the present invention, the term "halogen atom" is understood to mean any halogen atom, advantageously chosen from Cl, Br, I or F, in particular chosen from F, Cl or Br, in particular F or Cl. within the scope of the present invention, the term "(C 1 -C 6) alkyl group" means any linear or branched alkyl group of 1 to 6 carbon atoms, in particular methyl, ethyl, n-propyl or iso-propyl, n-butyl, iso-butyl, sec-butyl, t-butyl, n-pentyl, n-hexyl. Advantageously it is a methyl, ethyl, iso-propyl or t-butyl group, in particular of a methyl or ethyl group, more particularly of a methyl group. In the context of the present invention, the term "C3-C6 cycloalkyl group" means any saturated and hydrocarbon-based cycle comprising from 3 to 6 carbon atoms, in particular the cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl group. Advantageously, it is a cyclopropyl or cyclohexyl group.
[0018] In the context of the present invention, the term "(C 1 -C 6 alkyl) aryl" means any aryl group as defined above bonded through a C 1 -C 6 alkyl group as defined herein. -above. In particular, an example of (C 1 -C 6 alkyl) aryl is benzyl or - (CH 2) 2 phenyl.
[0019] In the context of the present invention, the term "pharmaceutically acceptable" is meant to be useful in the preparation of a pharmaceutical composition which is generally safe, non-toxic, and neither biologically nor otherwise undesirable and which is acceptable for veterinary use as well. than human pharmaceutical. Within the scope of the present invention, the term "pharmaceutically acceptable salts of a compound" means salts which are pharmaceutically acceptable, as defined herein, and which possess the desired pharmacological activity of the parent compound. Such salts include: (1) acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like; or formed with organic acids such as acetic acid, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, citric acid, ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, hydroxynaphthoic acid, 2-hydroxyethanesulfonic acid, lactic acid, maleic acid, malic acid, mandelic acid , methanesulfonic acid, muconic acid, 2-naphthalenesulfonic acid, propionic acid, salicylic acid, succinic acid, dibenzoyl-L-tartaric acid, tartaric acid, acid ptoluenesulfonic acid, trimethylacetic acid, trifluoroacetic acid and the like; or (2) salts formed when an acidic proton present in the parent compound is replaced by a metal ion, for example an alkali metal ion, an alkaline earth metal ion or an aluminum ion; either coordinates with an organic or inorganic base. Acceptable organic bases include diethanolamine, ethanolamine, N-methylglucamine, triethanolamine, tromethamine and the like. Acceptable inorganic bases include aluminum hydroxide, calcium hydroxide, potassium hydroxide, sodium carbonate and sodium hydroxide. In the context of the present invention, the term "solvate of a compound" is understood to mean any compound obtained by addition of an inert solvent molecule to the compound according to the invention, the solvate being formed by reason of their strength. mutual attraction. The solvates are, for example, alcoholates of the compound. A hydrate is a solvate in which the inert solvent used is water. It can be mono-, di- or tri-hydrated. In the context of the present invention, the term "tautomer" means any isomer of constitution of the compounds according to the present invention which are interconvertible by the reversible chemical reaction known as tautomerization. In most cases, the reaction occurs by migration of a hydrogen atom accompanied by a change of localization of a double bond. In a solution of a compound capable of tautomerization, an equilibrium between the two tautomers is created. The ratio of tautomers is then a function of the solvent, the temperature and the pH. The tautomerism is therefore the transformation of one functional group into another, most often by concomitant displacement of a hydrogen atom and a bond 7 (double or triple bond). Common tautomers are, for example, aldehyde / ketone-alcohol pairs or more precisely enol pairs; amides - imidic acids; lactams - lakes; imines - enamines; enamines - enamines. In particular, it may include a chain-ring tautomerism that takes place when the proton movement is accompanied by the transformation of an open structure to a cycle.
[0020] Description of Syntheses and General Schemes Compounds of general formula (I) may be prepared by application or adaptation of any method known per se to those skilled in the art and / or within the scope of the latter, in particular those described by Larock (1989). ), or by application or adaptation of the processes described in the following procedures. The different groupings refer to the previously given definitions.
[0021] Scheme A: The 20-hydroxyecdysone Al can be reduced to compound A2 by the action of zinc in acetic acid as described in Zhu et al. (2002). This compound A2 can undergo an oxidative cleavage C20-C22 of the chain by reaction of the PCC in pyridine to give the derivative A3. R5ONH2-type alkyloximes react on the C20 carbonyl to give the corresponding A4 imines as well as the C20 and C6 double reaction by-product A5. ## STR2 ## Scheme B: R5ONH2 alkyloximes react on the C6 carbonyl of compound Al to give oxime B1 as well as, optionally by-products B2 (Z-conformant) and B'2 (E-conforming) to remove the C14-C15 hydroxyl. These 3 products can independently undergo a chain break as described in Scheme A to give the products B3 and B4, with byproduct (Z) -oxime B'3. R5ONH2 alkyloximes react on the C6 carbonyl of the B3 or B4 compounds to give the B5 and B6 products. HO HO HO HO HO HO HO HO HO HO HO HO HO HO HH, ORS Rs0 / 13'3 HO HO NHN SORS Rs0 '13, Scheme C: Compound A1 can undergo oxidative cleavage as described in diagram A to give the product C1. This compound named Poststerone in the literature can undergo the action of an alkoxime of R5ONH2 type on the carbonyl in C20, which makes it possible to obtain the product C2, the by-product C3 of double reaction in C6 and C20 and the sub -product C4 removal of the C14-C15 hydroxyl. Scheme D: The mixture of conformers (E) and (Z); B3 and B'3 from Scheme B is reacted with titanium chloride, which has the effect of dehydrating the compound (Z); B'3 to get the D1. The C17 carbonyl of the product B3 isolated in the preceding step undergoes reductive amination with R3NH2 in the presence of sodium cyanoborohydride to give the product D2, which can be acylated with an acid chloride R4COCI, allowing the derivation D3 to be obtained. Figure E: Poststerone C1 undergoes a reductive amination followed by an acylation of the same type as those described in Scheme D and makes it possible to obtain products E1 and E2. ## STR2 ## Scheme F: The secondary amine of compound E1 from Scheme F is alkylated with a bromoalkyl derivative to give tertiary amine F2.
[0022] ## STR2 ## Scheme G: Poststerone C1 can be brominated to C21 with bromine to give the brominated derivative G1 which can be alkylated by a nucleophile WR, W being amine or thiol and give the compound G2. ## STR1 ## The brominated derivative G1 obtained in Scheme G can be reacted with OR-type alcoholates to give the ether products H1. ## STR6 ## Scheme I: G2 derivatives from Scheme G can be reduced by C20 carbonyl with sodium borohydride to give alcohols 12. 302 1 3 1 8 22 WR WR HO The G2 derivatives from Scheme G can undergo the C20 reaction of an R5ONH2-type alkoxamine as described in Scheme C and provide compound J1. Examples: Materials and Methods The proton (1H) nuclear magnetic resonance (NMR) spectra are carried out on a Bruker Avance DPX300 (300.16 MHz) apparatus. The chemical shifts (δ) are measured in parts per million (ppm). The spectra are calibrated on the chemical shift of the deuterated solvent used. The coupling constants (J) are expressed in Hertz (Hz) and the multiplicity is represented in the following manner, singlet (s), doublet (d), doublet of doublet (dd), triplet (t), triplet of doublet ( td), quadruplet (q), multiplet (m). The mass spectra (SM) are made by an Agilent Technologies MSD spectrometer, type G1946A, the samples are ionized by an "Atmospheric pressure chemical ionization" (APCI) source. Abbreviations TBAF tetrabutylammonium fluoride THF tetrahydrofuran DMF dimethylformamide CDCl3 deuterated chloroform CD3OD deuterated methanol DMSO-d6 dimethylsulfoxide deuterated PyBop (Benzotriazol-1-yloxy) tripyrrolidinophosphonium hexafluorophosphate Boc tert-Butyloxycarbonyl mmol millol (s) micromolar uM ml milliliter (s) g gram (s) ) M mol / liter N normal nm nanometer (s) min minute (s) h hour (s) d day (s) ta ambient temperature ultraviolet UV ctrl control MW molecular weight SM mass spectrometry As illustrative examples of the invention, the molecules shown in Table 2 were synthesized.
[0023] Table 2: List of molecules whose synthesis is exemplified. No. Chemical structure Chemical name 1 HO 011 N (2S 3R 5R 1 OR 13S 14S 17S) -17- (N-but-3-enoxy-C-methyl-carbonimidoyl) -2,3-dihydroxy-10,13-dimethyl-1, 2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopenta [a] phenanthrene-6-one H OS H 1, O 2 H el> N (2S, 3R, 5R, 10R 13S, 14R, 17S) -17- (N-but-3-enoxy-C-methyl-carbonimidoyl) -2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,9,11, 12,14,15,16,17-dodecahydrocyclopenta [a] phenanthrene-6-one OS - "-, - O 3 ee N Acid 2 - [[(2S, 3R, 5R, 10R 13S, 17S) (N-, es (carboxymethyloxy) -C-methyl-carbonimidoyl) -2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,9,11,12 , 14,15,16, 17dodecahydrocyclopenta [a] phenanthrene-6-ylidene] amino] oxyacetic acid. O 4, OS N 2- [1 - [(2S, 3R, 5R, 10R, 13S, 17S) -2,3-HOe. dihydroxy-10,13-dimethyl-6-oxo-1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopenta [a] phenanthrene-17-yl] ethylideneamino] oxyacetic acid HO ° H HO ee N (2S, 3R, 5R, 10R, 13S, 17S) -17- (N-ethoxy-C-methylcarbonimidoyl) -2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,9,11 , 12,14,15,16,17-dodecahydrocyclopenta [a] phenanthrene-6-one OS 0 HO, O 6 H 011 N (2S, 3R, 5R, 10R, 13S, 17S) -2,3-dihydroxy-17 - (N-hydroxy-C-methyl-carbonimidoyl) -10,13-dimethyl-1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopenta [a] phenanthrene-6-one HO OS OH, O 7 H OS N c. (2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -6-methoxyimino-17- (N-hydroxy-C-methyl-carbonimidoyl) -10,13-dimethyl-2,3,4,5,9, 11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-2, 3,14-triol, ee H 1 O / N 1 8 H ee HO OH OH. (2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -6-ethoxyimino-10,13-dimethyl-17 - [(1R, 2R) -1,2,5-trihydroxy-1,5-dimethylhexyl) ] -2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene2,3,14-triol e% H, N N0 / - ,. ee9 H OS%,. 1 - [(2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -6-ethoxyimino-2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11 , 12,15,16, 17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethanone, HN, ..., 10, OS OH. (2R, 3R) -2 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,3,4,5,9 11,12,16,17-Decahydrocyclopenta [a] phenanthrene-17-yl] -6-methyl-heptane-2,3,6-triol, ## STR2 ## (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-17 - [(1R, 2R) -1,2,5-trihydroxy-1,5-dimethyl) hexyl] -2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one oxime HO .... ,,, OH H l> N, O, OH OH (2S, 3R, 5R, 10R, 13R, 17S) -2,3-dihydroxy-10,13-dimethyl-17 - [(1R, 2R) -1, 2,5-trihydroxy-1,5-dimethylhexyl] -1,2,3,4,5,9,11,12,16,17-, HN decahydrocyclopenta [a] phenanthrene-6-one -Z-OH oxime, .beta. (OH, OH) OH (OH, OH, R, R, R, R, R, R, R, R, R, R, W), -6-methoxyimino-10,13-dimethyl-17- [( 1R, 2R) -1,2,5-trihydroxy-1,5-dimethyl-hexyl] -2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene2,3,14-triol, N ........ 0 14 H el> 0 1 - [(2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -2,3,14- trihydroxy-6-methoxyimino-10,13-diméthyl2,3,4,5,9,11,12,15, 16,17-Decahydro-1Hcyclopenta [a] phenanthrene-17-yl] ethanone HO OS OH, N 15 H 0 / N O 1 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2.3 6-dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,3,4,5,9,11,12,16,17-decahydrocyclopenta [a] phenanthrene-17-ygéthanone HO 'el Oie, 16 H OS OH. eetrihydroxy-6-hydroxyimino-10,13-dimethyl-1 - [(2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -2,3,14- 2,3,4,5,9,11,12 , 15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethanone, N ...... ', 17, ae O 1 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-hydroxyimino-10,13-dimethyl-1,2,3,4,5,9,11,12,16,17-decahydrocyclopenta [a] phenanthrene-17-ygéthanone, e "/ N H O, Se o, 1 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,3,4,5, 9,11,12,16,17-decahydrocyclopenta [a] phenanthrene-17-ygéthanone oxime HO OS 0 ,,, NH 19, ee N o ---- _. (25,3R, 5R, 6E, 10R 13R, 145, 175) -17- (N- (2-methoxyethoxy) -C-methyl-carbonimidoyl) -6-methoxyimino-10,13-dimethyl-OS 75, 15,16,17-decahydro-1H-cyclopenta [a] ] phenanthrene-2,3,14-triol HN 0/20 H N O N O 1 - [(25,3R, 5R, 6Z, 10R, 13R, 145,175) -2,3,14-trihydroxy-6-methoxyimino-10 13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethanone, OS Ee H, , 3R, 5R, 10R, 13R, 145.175) -2,3,14-tri hydroxy-10,13-dimethyl-17- (C-methyl-N- (3-methylbut-2-enoxy) carbonimidoyl) -2,3,4,5,9,11,12,15,16,17-decahydro-1H cyclopenta [a] phenanthrene-6-one oxime ## STR5 ## wherein R 1 is OH (2R, 3R) -2 - [(25.3R, 5R, 6E, 10R, 13R, 175) -2, 3-Dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,3,4,5,9,11,12,16,17-decahydrocyclopenta [a] phenanthrene-17-yl] -6-methyl-heptane-2 , 3,6-triol, OS NINI. H 2 O (N, O, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R, R are generally 4,5,9,11,12,15,16,17-DecahydroH-cyclopenta [a] phenanthrene-6-one, OS% HH 0 24H e N OH (25.3R, 5R, 10R, 13R, 145.175) -2,3,14-trihydroxy-17- (N-hydroxy-C-methyl-carbonimidoyl) -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-H-cyclopenta [a] phenanthrene-6-one HO OS, 3, h. (25.3R, 5R, 10R, 13R, 145.175) -17- (N-methoxy-C-methyl-carbonimidoyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9, 11,12,15,16,17-DecahydroH-cyclopenta [a] phenanthrene-6-one, OS OH H. N 2 - [1 - [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-O trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-17yl] ethylideneamino] oxyacetic acid, ee. OH OS 6HH O 27 H (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-17- (C-methyl-N- (2-phenoxyethoxy) ) carbonimidoyl) 2,3,4,5,9,11,12,15,16,17-decahydro-1Hcyclopenta [a] phenanthren-6-one H OS '- - c 01. 28 N (2S, 3R) 5R, 10R, 13R, 14S, 17S) -17- (N-but-3-enoxyC-methyl-carbonimidoyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9, 11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one, ## STR1 ## (2S, 3R, 5R, 10R, 13R) 14S, 17S) -2,3,14-trihydroxy-17- (N- (2-methoxyethoxy) -C-methylcarbonimidoyl) -10,13-dimethyl-2,3,4,5,9,11,12,15, 16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one, ## STR1 ## (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2 , 3,14-trihydroxy-10,13-dimethyl-17- (C-methyl-N- (3-methylbut-2-enoxy) carbonimidoyl) -2,3,4,5,9,11,12,15,16, 17-decahydro-1H-cyclopenta [a] phenanthrene-6-one O, ee OS -%, HH 0 31 HO ** (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14- trihydroxy-10,13-dimethyl-17- (C-methyl-N- (2-morpholinoethoxy) carbonimidoyl) -2,3,4,5,9,11,1 2,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one H + 32. (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (N- (2-diethylaminoethoxy) -C-methyl-carbonimidoyl) -2,3,14-trihydroxy-10,13-dimethyl- 2,3,4,5,9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one HN 0 0 0 - N - H - H 0 33 H (2S, 3R, 5R, 10R, 13R, 17S) -2,3-dihydroxy-10,13-dimethyl-17- (C-methyl-N- (2-phenoxyethoxy) carbonimidoyl) 1,2,3,4 5,9,11,12,16,17-Decahydrocyclopenta [a] phenanthrene-6-one ## STR4 ## Acid 2 - [[(2S, 3R, 5R, 10R, 13R, 14S, 17S) (N-H 0 (carboxymethyloxy) -C-methyl-carbonimidoyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11 , 12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-ylidene] amino] oxyacetic acid (N, N, N) 17S) -17- (N- (2-dimethylaminoethoxy) -C-methyl-carbonimidoyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15, 16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one (N, 2R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy10,13-diméthy1-17- (C-methyl N- (2-pyrrolidin-1-ylethoxy) carbonimidoyl) -2,3,4,5,9,11,12,15,16,17-decahydro-1Hcyclopenta [a] phenanthrene-6-one eel 0% H - HO ___O H 37 HO /. N- (2,2-difluoroethyl) -N41-h OS. F [(2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-6-methoxyimino-10,13-dimethyl-2,3,4,5,9,11,12, 15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyleuran-2-carboxamide NHLN-38H1O N- (2,2-dimethoxyethyl) -2-methyl-N41- [(2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-6-methoxyimino-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro -1Hcyclopenta [a] phenanthrene-17-ygthyl] propanamide t. h OS N hN. 0 39 h OS HHF (2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -17- [1- (2,2-difluoroethylamino) ethyl] -6-methoxyimino-10,13-dimethyl-2,3, 4,5,9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene2,3,14-triol N0 40 hrs. 5R, 6E, 10R, 13R, 145, 175) -17- [1- (2,2-dimethoxyethylamino) ethyl] -6-methoxyimino10,13-dimethyl-2,3,4,5,9,11,12,15, 16,17-Decahydro-1H-cyclopenta [a] phenanthrene2,3,14-triol HO-NH 2 0H-O-2-methoxy-N- (2-methoxyethyl) -N- [1- [( 2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy10,13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17decahydro 1H-cyclopenta [a] phenanthrene-17-yl] ethyl] acetamide ## STR5 ##, H 2 O 42 H OS H (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2, 3,14-trihydroxy-1741- (2-methoxyethylamino) ethyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1-cyclopenta [a] phenanthrene-6- ## STR2 ## 43 H / = - N (25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-1771- (3H) OS 0, t 4 h pyridylmethylamino) ethyl] -2,3,4,5,9,11,12,15,16,17-d 1H-cyclopenta [α] phenanthrene-6-one 1H-44He NN (25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-1741- (2-morpholinoethylamino) ethy2,3,4,5,9,11,12,15,16,17-decahydro-1Hcyclopenta [a] phenanthrene-6-one h Sil Ti, ------ h / N ---- 45 ° F (45.3R, 5R, 10R, 13R, 145.175) -17- [1- (cyclopropylamino) ethyl] -2,3,14-trihydroxy-10,13-dimethyl-2,3,4 , 5,9,11,12, 15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one HO (H, O) O (N, 25, 3R, 5R, 10R, 13R, 145, 175) - 2,3,14-trihydroxy-10,13-dimethyl-1741- [1-2-ylmethylamino) ethyl] -2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [ a] phenanthrene-6-one ll. ## STR5 ## N- (tetratetrahydrofuran-2-ylmethyl) -N [1- [(25,3R, 5R, 10R, 13R, 145, 175) -2,3,14-trihydroxy-10,13-dimethyl) 6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-methylcyclopropanecarboxamide O (N-O-N- (tetratetrahydrofuran-2-ylmethyl) -N41- [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2 , 3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] prop-2-enamide, 1> O, -O H O 49 OO N- (2-methoxyethyl) -N41-N [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] furan-2-carboxamide, - HO. OS HN N- (tetratetrahydrofuran-2-ylmethyl) -N [1- [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3 , 4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyl] propanamide, ## STR2 ## --- ,, 2-ethyl- N- (2-methoxyethyl) -N [1- e. [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4 , 5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ytgyl] butanamide HO OS -, -, ## STR2 ## methoxyethyl) -N [1- [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo] 2,3,4,5,9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] pent-4-enamide N N- (2-methoxyethyl) -N 4 -H-N- [1H] [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy], 13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthren-17-yl] ethyl] thiophene-2-carboxamide HO ## STR2 ## N-Cyclopropyl-2-methoxy-N- [1H] - [(25,3R, 5R, 10R, 13R, 145, 175 ) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17- N-N-Cyclopropyl-N- [1 - [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl) 1-6-Oxo-2,3,4,5,9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-17-ylgyl] propanamide, m.p. 4-Cyano-N-cyclopropyl-N- [1-HO OS LN [(25,3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy10,13 dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] benzamide H 0 H 0 57 HO OS e. NoyoN- (2-methoxyethyl) -N41- [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy10,13-dimethyl) oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] morpholine-4-carboxamide H 0 58 H ee HN N-cyclopropyl-N- [1 - [(2S, 3R, 5R, 10R, 13R, 145, 175) 2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9, 11,12,15,16,17-Decahydro-1Hcyclopenta [a] phenanthrene-17-yl] ethyl] pyridine-3-carboxamide Hexamino-N-cyclopropyl-4-methoxy-N- [1-N] [(25.3R, 5R, 10R, 13R, 145, 175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17 decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] benzamide and H 2 O -H 2 H 60 O- (2,2-dimethoxyethyl) -N [1- [[25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyleuran-2-carboxamide 0 ° NO e. ## STR21 ## N- (2,2-dimethoxyethyl) -N [1- O- [(2S, 3R, 5R, 10R, 13R, 14S, 175) -2,3,14-trihydroxy10,13- dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] prop-2-enamide. 0 H 2 O-methoxy-N- (tetratetrahydrofuran-2-ylmethyl) -N- [1 - [(25,3R, 5R, 10R, 13R, 145,175) -2 , 3,14-Trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl ] ethyl] acetamide N 111 0 H OS --L hh 0 63 H / N- (tetratetrahydrofuran-2-ylmethyl) -N41- [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14- trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyleuran-2-carboxamide δ * 0 HO 0 HN e 0: - "HO 64 hrs / h Osyl] ethyl] thiophene-2-carboxamide N- (2,2-dimethoxyethyl) -N [1- O [(25,3R, 5R, 10R, 13R) , 145,175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene; 17- 0 N ee 0. N- (2,2-dimethoxyethyl) -N41- [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo] 2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyl] cyclopropanecarboxamide e. Embedded image 13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyl] propanamide N HO el> 0 h OS - 677 N- (2,2-difluoroethyl) -N [1- [[(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl] -6- -oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyleuran-2-carboxamide 0 FNF e. N- (2,2-difluoroethyl) -N41-F [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo] -2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyl] cyclopropanecarboxamide. ## STR13 ## N- (2,2-difluoroethyl) -N41-O [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl) 2,3,4,5-oxo, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] prop-2-enamide FN e. 70, F (25,3R, 5R, 10R, 13R, 145,175) -17- [1- (2,2-difluoroethylamino) ethyl] -2,3,14-trihydroxy-10,13-dimethyl-2-yl , 3,4,5,9,11,12, 15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one HO 11 H OS LH 0 71) L-tert-butyl N- ( 2,2-difluoroethyl) -N41- [1] [(25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl) 2,3,4,5-oxo, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] carbamate; 72H-decahydro-1H-cyclopenta [a] phenanthrene-17-2-methoxy-N- (3-pyridylmethyl) -N41- [(25,3R, 5R, 10R, 13R, 145, 175) -2.3 14-Trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-yl] ethyl] acetamide. ## STR5 ## 3,4,5,9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyleuran-2-carboxamide NN el> O 74 0 - [1 N] ee10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17- N- (3-pyridylmethyl) N41- [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxydecahydro-1H-cyclopenta [a] phenanthrene-17-ygthyl] cyclopropanecarboxamide ## STR2 ## 75 HO 00 0) .... N- (2-methoxyethyl) -2-methyl-N41-, N [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy10, 13-dimethyl-6-oxo-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyl] propanamide -III ,, H. Ni (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-1741- (2-methoxyethyl (methypamino) ethylF 10,13-dimethyl-2,3,4,5,9, 11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one H 00 k, h H 0 77 / (2S, 3R, 5R, 10R, 13R, 14S 17S) -2,3,14-trihydroxy-10,13-dimethyl-1741- [1 (methyl (tetratetrahydrofuran-2-ylmethylamino) ethyl] -2,3,4,5,9,11,12,15,16, 17-decahydro-1H-cyclopenta [a] phenanthrene-6-one 0. ## STR2 ## cyclopropyl (methypamino) ethyl] -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one ## STR1 ## O, 2,3,4,5,9,11,12,15,16,17-Decahydro-1H (2S, 3R, 5R, 10R) 13R, 14S, 17S) -17- [1- (2,2-dimethoxyethyl (methylamino) ethyl] -2,3,14-trihydroxy-10,13-dimethylcyclopenta [a] phenanthrene-6-one h. 80 / F (2S, 3R, 5R, 10R, 13S, 17S) -2,3-dihydroxy-10,13-dimethyl-17 - [(E) -3- (1-methylpyrrol-2-yl) -2-enoyl) ] -1,2,3,4,5,9,11,12,14,15,16,17- dodecahydrocyclop enta [a] phenanthrene-6-one h ee F OS L h H 0 81 HON (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-17- ( 2-morpholinoacetyl) 2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one, salt ee. ## STR5 ## (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- [2- (4-ethylpiperazin-1-ylacetyl) -2,3,14-trihydroxy) , 13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one HON (O1, 3R, 5R, 10R, 13R, 14S, 17S) -17- [2 - [(2S, 6R) -2,6-dimethylmorpholin-4-yl] acetyl] -2,3,14-trihydroxy-10,13-dimethyl2, 3,4,5,9,11,12,15,16,17-decahydro-1Hcyclopenta [a] phenanthrene-6-one, O5.1 / -He5, O 84 HON (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- [2- (2-dimethylaminoethyl (methylamino) acetyl] -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15, 16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one, O 51 .NH NH, O 85 HO, OOS 6, N (2S, 3R, 5R, 10R, 13R, 14S, 17S) [ 2- (2,2-dimethoxyethyl (methylamino) acetyl] -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [ a] phenanthrene-6-one HO 511> 86 HON (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-1742- (3-hydroxypyrrolidin-1-ypacetyl) - 10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahy 1H-cyclopenta [a] phenanthrene-6-one, Se 511> OH H - '%, O 87 HON (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy 1742- (2) hydroxyethyl (methypamino) acetyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one, HOO 88 H 0 H (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-1742- (4-hydroxy-1-piperidypacetyl) -10,13-dimethyl-2,3, 4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one OS ## STR2 ## 14S, 17S) -2,3,14-trihydroxy-1742 [4- (2-hydroxyethyl) -1-piperidyl] acetylF 10,13-dimethyl-2,3,4,5,9,11,12,15,16, 17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one NH 2 O 3 H 2 H 90 HO (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl 1742- (4-methyl-1-piperidypacetyl) -2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one H 0 H 91 HO 0 (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- [2- (3-dimethylaminopropyl (methypamino) acetyl] -2,3,14-trihydroxy-10,13-dimethyl2 , 3,4,5,9,11,12, 15,16,17-Decahydro-1Hcyclopenta [a] phenanthrene-6-one OS ## STR1 ## Ethyl 2- [2-oxo-2 - [(2S, 3R, 5R), 10R, 13R, 14S, 17S) - Bis 2,3,14-trihydroxy-10,13-dimethyl-6-oxo2,3,4,5,9,11,12,15,16,17-decahydro-1Hcyclopenta ethyl [ ] phenanthrene-17-ylethyl] sulfanylacetate HO ## STR13 ##, (O, R, R, R, R, R, 14S, 17S) -2- (2-ethylsulfanylacetyl) -2,3 14-Trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one H '/ OS' 0, h H, HO (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy 1742- (2-hydroxyethylsulfanypacetyl) -10,13-dimethyl-2,3,4,5,9,11 12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one OS sh '/ H' hh ° 95 HO. (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (2-ethoxyacetyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12, 15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one HOO. (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-17- (2-tetratetrahydrofuran-3-yloxyacetyl) -2,3,4,5,9, 11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one H OS O H eill> -'-ach O 97 H HO (2S, 3R, 5R, 10R, 13R, 14S, 17S ) -2,3,14-trihydroxy-17 [1-hydroxy-2- (2-hydroxyethyl (methylamino) ethyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16, 17-decahydro-1H-cyclopenta [a] phenanthrene-6-one (b) SO 2 H 2 O, HO 98 HO (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2.3; 14-Trihydroxy1741-hydroxy-2- (2-hydroxyethylsulfanyl) -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6- ## STR1 ## (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy 1741-hydroxy 244- (2-hydroxyethyl) -1-piperidynethyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one H ## STR2 ## -2,3,4,5,9,11,12,15,16,17- dec ahydro-1H-cyclopenta [a] phenanthrene-6-one HO OS eill> H ', h, OH 101 HO to N 2S, 3R, 5R, 10R, 13R, 14S, 17S-17- 2-bromoacet 1 -, OS N () (Y) H ee. 2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one DH N 0 102 H Br (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (2-bromoacetyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11 12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthren-6-one, Example 1: Scheme A; Preparation of Derivatives Nos. 1 and 2: (2S, 3R, 5R, 10R, 13S, 14S, 17S) -17- (N-but-3-enoxy-C-methylcarbonimidoyl) -2,3-dihydroxy -10,13-dimethyl-1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopentafflphenanthrene-6-one and (2S, 3R, 5R, 10R, 13S, 14R, 17S) -17- (N-but-3-enoxy-C-methyl-carbonimidoyl) -2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,9,11,12,14 , 15,16,17-dodecahydrocyclopentafflphenanthrene-6-one. Product 1 Product 2 Step 1: Preparation of (2S, 3R, 5R, 10R, 13S, 17S) -2,3-dihydroxy-10,13 - dimethyl-17 - [(1 R, 2R) -1,2,5-trihydroxy-1,5-dimethylhexyl] 1,2,3,4,5,9,11,12,14,15,16 , 17-dodecahydrocyclopentafflphenanthrene-6-one 20-hydroxyecdysone (commercially available) are solubilized in 280 mL of acetic acid and the solution is heated to 67 ° C (41.6 mmol). C. 27.2 g (416 mmol) of zinc powder are added portionwise and the reaction medium is heated at 67 ° C. for 18 h. Then, the solution is filtered at 20 ° C through a cake of Celite which is washed with 50 mL of methanol. The filtrate is evaporated to give 33.7 g of brown oil which is purified by flash chromatography on a silica gel cartridge (90/10 dichloromethane / methanol) to give 9.52 g of yellow powder (Yield: 49%) of (2S, 3 R, 5R, 10R, 13S, 17S) -2,3-dihydroxy-10,13-dimethyl-1771 (1R, 2R) -1,2,5-trihydroxy-1,5-dimethylhexyl] 1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopenta [a] phenanthrene-6-one. LC-MS: m / z = 465.3 (MH +) UV purity at 254 nm = 99%. 1H NMR (300 MHz, DMSO-d6) 5.72-5.43 (m, 1H (C7)), 4.42-4.32 (m, 2H), 4.13 (s, 1H), 3.76-2.62 (m, 2H), 3.2- 3.1 (m, 2H), 2.21-2.14 (m, 2H), 1.90-1.02 (m, 28H), 1.03-0.77 (m, 6H). Step 2: Preparation of (2S, 3R, 5R, 10R, 13S, 17S) -17-acetyl-2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,9,11,12 , 14,15,16,17-dodecahydrocyclopentafflphenanthrene-6-one 9.52 g (20.28 mmol) 2S, 3R, 5R, 10R, 13S, 17S) -2,3-dihydroxy-10,13-dimethyl- 174 (1 R, 2 R) -1,2,5-trihydroxy-1,5-dimethylhexylF 1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopenta [ a] phenanthrene-6-one are solubilized in 46 mL of pyridine and 276 mL of dichloromethane. 6.69 g (30.4 mmol) of pyridinium chlorochromate are added portionwise over 10 minutes and the reaction medium is stirred at 20 ° C. for 2.5 hours. The pyridine and dichloromethane are then evaporated under vacuum and the residue is purified by flash chromatography on a silica gel cartridge (dichloromethane / methanol, 95/5) to give 4 g of beige powder (Yield: 56%) of (2S, 3R, 5R, 10R, 13S, 17S) -17-acetyl-2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,9,11,12,14,15,16,17 -dodécahydrocyclopenta [a] phenanthren-6-one. LC-MS: m / z = 347.2 (MEI +) UV purity at 254 nm = 99%. 1H NMR (300 MHz, DMSO-d6) b 5.68-5.46 (m, 1H (C7)), 4.41-4.37 (m, 2H), 3.76-3.55 (m, 2H), 2.83-2.54 (m, 2H), 2.33-1.95 (m, 6H), 1.90-1.30 (m, 10H), 1.28-1.18 (m, 1H), 0.88-0.42 (m, 6H).
[0024] Step 3: Preparation of epimers (2S, 3R, 5R, 10R, 13S, 14S, 17S) -17- (N-but-3-enoxy-C-methyl-carbonimidoyl) -2,3-dihydroxy-10,13 1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopentafflphenanthrene-6-one and (2S, 3R, 5R, 10R, 13S, 14R, 17S) -17- (N-but-3-enoxy-C-methyl-carbonimidoyl) -2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,9,11,12,14,15,16, 17-dodecahydrocyclopentafflphenanthrene-6-one O, NH 2 HO 2 Product 1 Product 2,328 mg (0.947 mmol) of (2S, 3R, 5R, 10R, 13S, 17S) -17-acetyl-2,3-dihydroxy- 10,13-dimethyl-1,2,3,4,5,9,11,12,14,15,16,17-dodecahydrocyclopenta [a] phenanthrene-6-one (14-deoxy-poststerone) prepared in accordance with step 2 are solubilized in 1.2 mL of ethanol and 200 mg (0.994 mmol) of but-3-enoxyammonium 2,2,2-trifluoroacetate are added portionwise. The reaction medium is refluxed for 20 h. The solvent is evaporated and the residue is purified by preparative chromatography on a C18 column (acetonitrile / water, 60/40) to give 24 mg of beige powder (yield: 6%) of product No. 01 (2S, 3R, 5R, 10R, 13S, 14S, 17S) -17- (N-but-3-enoxy-C-methylcarbonimidoyl) -2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,9,11 , 12,14,15,16,17-dodecahydrocyclopenta [a] phenanthrene-6-one and 57 mg of beige powder (yield: 14%) of product No. 2 (2S, 3R, 5R, 10R, 13S, 14R, 17S) -17- (N-but-3-enoxy-C-methyl-carbonimidoyl) -2,3-dihydroxy-10,13-dimethyl-1,2,3,4,5,9,11,12,14 , 15,16,17-dodécahydrocyclopenta [a] phenanthren-6-one. Product No. 1: LC-MS: m / z = 416.2 (MH +) UV purity at 254 nm = 99%. 1 H NMR (300 MHz, DMSO-d 6) - C14 β-epimer: δ 5.83-5.72 (m, 1H), 5.70 (s, 1H (C7)), 5.1-5 (m, 2H), 4.40-4.36 (m). , 2H), 4 (t, 2H), 3.77-3.71 (m, 2H), 2.80-2.60 (m, 1H), 2.40-1.20 (m, 20H), 0.82-0.74 (m, 6H). Product no. 2: LC-MS: m / z = 416.2 (MH +) UV purity at 254 nm = 99%. 1 H NMR (300 MHz, DMSO-D6) - C14 alpha epimer - δ 5.87-5.72 (m, 1H), 5.48 (s, 1H (C7)), 5.1-4.9 (m, 2H), 4.40-4.36 (m , 2H), 4 (t, 2H), 3.77-3.71 (m, 2H), 2.80-2.60 (m, 1H), 2.44-1.23 (m, 20H), 0.83 (s, 3H), 0.47 (s, 3H). Derivatives Nos. 3 to 6 were prepared according to the same scheme, in the form of a mixture of C14 alpha and C14 beta epimers.
[0025] No. PM Appearance, MS MS m / z 1F1 NMR (300 MHz, DMSO-d6) 8 g / mol MH purities (%) 3 492.6 beige powder 92 493.2 8.56 (s, 1H), 7.78 (s, 1H), 6.34 -5.47 (m, 1H (C7)), 4.48 (m, 4H), 3.72 (m, 3H), 2.28-1.30 (m, 20H), 0.85-0.44 (m, 6H) 4 419.5 beige powder 92 420.2 5.69- 5.46 (m, 1H (C7)), 4.43 (s, 2H), 3.74-3.64 (m, 3H), 2.80-2.60 (m, 1H), 2.31-1.16 (m, 19H), 0.85-0.44 (m, 6H) 5 389.5 white powder 94 390.2 5.70-5.47 (m, 1H (C7)), 4.39-4.36 (m, 2H), 4.02-3.95 (q, 2H), 3.76-3.60 (m, 2H), 2.80-2.60 (m, 1H), 2.41-1.2 (m, 18H), 1.15 (t, 3H), 0.83-0.47 (m, 6H) 6 361.5 white powder 93 362.2 10.44-10.39 (m, 1H), 5.67-5.47 (m , 1H (C7)), 4.37- 4.35 (m, 2H), 3.75-3.60 (m, 2H), 2.80-2.60 (m, 1H), 2.45-1.1 (m, 18H), 0.83-0.45 (m, 6H). LCMS purity, UV at 254 nm. Example 2: Scheme B; Preparation of Derivative No. 7: (1 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,3,4 , 5,9,11,12,16,17-decahydrocyclopentafflphenanthrene-17-yl] ethanone oxime] and derivative # 19 :( (2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -17- (N- (2-methoxyethoxy) -C-methyl-carbonimidoyl) -6-methoxyimino-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H cyclopentafflphenanthrene2,3,14-triol] HO HO C (N Product 7 Product 19 Preparation of the product No. 7 Step 1: Preparation of the derivatives No. 13 [(2S, 3R, 5R, eE, 10R, 13R, 14S, 17S ) 6-Methoxyimino-10,13-dimethyl-17 - ((1R, 2R) -1,2,5-trihydroxy-1,5-dimethyl-hexyl] -2,3,4,5,9,11 , 12,15,16,17-decahydro-1H-cyclopentafflphenanthrene-2,3,14-triol] and No. 10 [(2: 1,3R) -2- [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,2,4,5,9,11,12,16,17-decahydrocyclopentafflphenanthrene 20 17-yl] -6-methyl -Heptane-2,3,6-triol] ## STR1 ## ## STR2 ## Same procedure as that described in step 3 of scheme A, 788 mg of beige powder (yield: 37%) of product No. 13 (25.3R, 5R, 6E, 10R, 13R, 14S, 17S) -6 Methoxyimino-10,13-dimethyl-17- [(1 R, 2 R) -1,2,5-trihydroxy-1,5-dimethylhexyl] -2,3,4,5,9,11,12 , 15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-2,3,14-triol were prepared from 20-hydroxyecdysone and O-methylhydroxylamine hydrochloride. 667 mg (Yield: 32%) of elimination by-product # 10 [(2R, 3R) -2- [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy- 6-methoxyimino-10,13-dimethyl-1,2,3,4,5,9,11,12,16,17-decahydrocyclopenta [a] phenanthrene-17-yl] -6-methyl-heptan-2, 3,6-triol] could also be isolated as well as 34 mg (Yield: 2%) of elimination by-product # 22 [(2R, 3R) -2 - [(2S, 3R, 5R, 6E, 10R 13R, 17S) - 2,3-dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,2,4,4,9,11,12,16,17-decahydrocyclopenta [a] phenanthrene-17- yl] -6-methyl-heptane-2,3,6-triol] could also be isolated.
[0026] Product No. 13: LC-MS: m / z = 510.2 (MH +) UV purity at 254 nm = 99%. 1 H NMR (300 MHz, DMSO-d 6) δ 6.25 (s, 1H (C7)), 4.45-4.35 (m, 3H), 4.314.29 (m, 1H), 4.14 (s, 1H), 3.74-3.69 ( m, 4H), 3.6-3.5 (m, 1H), 3.17-3.08 (m, 1H), 2.87-2.75 (m, 1H), 2.26-2.20 (m, 2H), 2.05-1.1 (m, 15H), 1.1-0.98 (m, 11H), 0.73 (s, 6H). Product No. 10: LC-MS: m / z = 492.2 (MH +) UV purity at 254 nm = 99%. 1 H NMR (300 MHz, DMSO-d 6) δ 6.04 (s, 1H), 5.77 (s, 1H), 4.45-4.30 (m, 2H), 4.25 (s, 1H), 4.11 (s, 1H), 3.75-3.65 (m, 5H), 3.63-3.55 (m, 1H), 3.20- 3.08 (m, 2H), 2.17-1.90 (m, 3H), 1.70-1.20 (m, 11H), 1.15-0.93 ( m, 14H), 0.74 (s, 3H). Product No. 22: LC-MS: m / z = 492.2 (MH +) UV purity at 254 nm = 99%.
[0027] 1 H NMR (300 MHz, DMSO-d 6) b 6.55 (s, 1H), 5.81 (s, 1H), 4.44-4.26 (m, 3H), 4.09 (s, 1H), 3.79-3.67 (m, 5H), 3.62-3.54 (m, 1H), 3.16-3.08 (m, 1H), 2.30-1.90 (m, 4H), 1.70-1.20 (m, 11H), 1.15-0.92 (m, 14H), 0.73 (s, 3H); ).
[0028] Starting with isolated derivative No. 10: Step 2a: Preparation of derivative No. 15: (11 (2S, 3R, 5c, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-methoxyimino-10,13 1,2,3,4,5,9,11,12,16,17-Decahydrocyclopentafflphenanthrene-17-yl] ethanone] Product 11010 Product No. 15 According to the same procedure as that described in Step 2 of Scheme A, 267 mg of beige powder (Yield: 55%) of 1 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-methoxyimino-10,13-dimethyl) 1,2,3,4,5,9,11,12,16,17-Decahydrocyclopenta [a] phenanthrene-17-yl] ethanone were prepared from product No. 10. LC-MS: m / z = 374.2 (MH +) UV purity at 254 nm = 99% 1H NMR (300 MHz, DMSO-d6) b 6.09 (s, 1H), 5.81-5.75 (m, 1H), 4.39-4.37 (m, 1H) , 4.30-4.26 (m, 1H), 3.76 (s, 3H), 3.72-3.68 (m, 1H), 3.65-3.55 (m, 1H), 3.2-3 (m, 2H), 2.75-2.60 (m, 1H), 2.29-2.10 (m, 5H), 1.74-1.23 (m, 8H), 0.74-0.70 (m, 6H) Step 3a: Preparation of derivative n7: [1-g2S, 3R, 5R, 6Z, 10R , 13R, 17S) - 2,3-dihydroxy-6-methoxyimino-10,13-dimethyl -1,2,3,4,5,9,11,12,16,17-decahydrocyclopentafflphenanthrene-17-yl] ethanone oxime] OH ,, HO Oe HO O. HO O, N OO HO HO HO HCI HO In accordance with the same procedure as that described in step 3 of scheme A, 81 mg of white powder (Yield: 71%) of - [(2S, 3R) , 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,3,4,5,9,11,12,16,17-decahydrocyclopenta [ a] phenanthrene-17-yl] ethanone oxime were prepared from product # 15. LC-MS: m / z = 389.2 (MH +) UV purity at 254 nm = 99%. 1 H NMR (300 MHz, DMSO-d 6) b 10.53 (s, 1H), 6.09 (s, 1H), 5.04 (s, 1H), 4.37 (d, 1H), 4.30-4.26 (m, 1H), 3.77-. 3.67 (m, 4H), 3.65-3.55 (m, 1H), 3.15-3.03 (m, 1H), 2.80-2.65 (m, 2H), 2.25-2.12 (m, 1H), 2.05-1.99 (m, 1H). ), 1.79 (s, 3H), 1.74-1.20 (m, 8H), 0.76-0.66 (m, 6H). Preparation of Product No. 19 Starting with the Isolated Derivative No. 13: Step 2b: Preparation of Derivatives No. 14: [1- g2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -2,3,14- trihydroxy-6-methoxyimino-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopentafflphenanthrene-17-yllethanonel and No. 20: [1-g2S] , 3R, 5R, 6Z, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-6-methoxyimino, 10,13-dimethyl-2,3,4,5,9,11,12,15,16 , 17-Decahydro-1Hcyclopentafflphenanthrene-17-yllethanone 14 Using the same procedure as that described in Step 2 of Scheme A, 891 mg of beige powder (yield: 36%) of product No. 14 [1- [(2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-6-methoxyimino-10.13 dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethanone] were isolated as well as 23 mg (Yield: 0.9 %) of product # 20: [1 - [(2S, 3R, 5R, 6Z, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-6-methoxyimino-10,13-dimethyl-2, 3,4,5,9,11,12,15,16,17-dice cahydro-1 Hcyclopenta [a] phenanthrene-17-yl] ethanone] from 3.5 g of product No. 13.
[0029] Product n14: LC-MS: m / z = 392.2 (MH +) UV purity at 254 nm = 99%. 1 H NMR (300 MHz, DMSO-d 6) δ 6.28 (s, 1H (C 7)), 4.74 (s, 1H), 4.42-4.36 (m, 1H), 4.32-4.28 (m, 1H), 3.76-3.70 ( m, 4H), 3.68-3.52 (m, 1H), 3.203.12 (m, 1H), 2.90-2.76 (m, 1H), 2.30-2.00 (m, 5H), 1.90-1.50 (m, 8H), 1.49-1.24 (m, 3H), 0.72 (s, 3H), 0.45 (s, 3H). Product No. 20: LC-MS: m / z = 392.2 (MH +) UV purity at 254 nm = 99%. 1 H NMR (300 MHz, DMSO-d 6) δ 5.71 (s, 1H (C 7)), 4.45 (s, 1H), 4.45-4.41 (m, 1H), 4.26-4.23 (m, 1H), 3.76-3.70 ( m, 4H), 3.65-3.55 (m, 1H), 3.18- 3.09 (m, 1H), 2.90-2.80 (m, 1H), 2.22-2.00 (m, 5H), 1.88-1.22 (m, 11); H), 0.73 (s, 3H), 0.47 (s, 3H). Step 3b: Preparation of Derivative No. 19: [(2S, 3R, 51: 1fiE, 10R, 13R, 14S, 17S) -17- (N- (2-methoxyethoxy) -C-methyl-carbonimidoyl) -6-methoxyimino 10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1Hcyclopentafflphenanthrene-2,3,14-trioll HO HO Product No. 19. HO HO Product No. 14 According to the same procedure as that described in step 3 of scheme A, 46 mg of white powder (Yield: 48%) of derivative # 19 [(2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -17- (N- (2-methoxyethoxy) -C-methylcarbonimidoyl) -6-methoxyimino-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17 decahydro-1H-cyclopenta [a] phenanthrene-2,3,14-triol] were prepared from 233 mg of product # 14. LC-MS: m / z = 465.2 (MH +) UV purity at 254 nm = 99%.
[0030] 1H NMR (300 MHz, DMSO-d6) b 6.28 (s, 1H (C7)), 4.66 (s, 1H), 4.44-4.38 (m, 1H), 4.34-4.28 (m, 1H), 4.10-4.01 ( m, 2H), 3.75-3.70 (m, 4H), 3.65-3.45 (m, 3H), 3.24 (s, 3H), 2.98-2.76 (m, 2H), 2.30-1.90 (m, 4H), 1.80- 1.24 (m, 12H), 0.73 (s, 3H), 0.49 (s, 3H).
[0031] Derivatives Nos. 8, 9, 11, 12, 16, 17, 18 and 21 were prepared according to the same scheme No. PM Appearance Purity SM m / z MH NMR H (300 MHz, DMSO-d5) 6 g / mol (%) 8 523.7 powder 99,524.3 (in D20) 8 6.43 (s, 1H (C7)), 4.13-3.85 (m, 4H), 3.35 (d, 1H), 2.88-2.80 (m, 1H) , 2.28-2.19 (m, 2H), 2.12-1.13 (m, 28H), 0.80 (m, 6H) white 9 405.5 powder 99 406.3 6.30 (s, 1H (C7)), 4.72 (s, 1H), 4.39 ( d, 1H), 4.30 (s, 1H), 4.05-3.9 (m, 2H), 3.74 (s, 1H), 3.63-3.55 (m, 1H), 3.16 (t, 1H), 2.89-2.79 (m, 1H), 2.3-2.01 (m, 6H), 1.89-1.2 (m, 10H), 1.15 (t, 3H), 0.72 (s, 3H), 0.45 (s, 3H). orange 11 495.7 powder 99 496.2 10.45-10.31 (m, 1H (N-OH)), 6.34-5.70 (m, 1H (C7)), beige 4.45-4.26 (m, 2H), 4.34 (s, 1H), 4.24 (s, 1H), 4.14 (s, 1H), 3.72 (s, 1H), 3.60-3.54 (m, 1H), 3.16-3.05 (m, 1H), 2.83-2.74 (m, 1H), 2.27-2.20. (m, 2H), 2-1.2 (m, 15H), 1.12-0.98 (m, 11H), 0.75-0.72 (m, 6H). 12 477.6 powder 99 478.2 10.59 (s, 1H), 6.07 (s, 1H), 5.72 (s, 1H), 4.40-4.32 (m, 2H), 4.24-4.20 (m, 1H), 4.12 (s, 1H) , 3.72-3.67 (m, 2H), 3.62-3.52 (m, 1H), 3.20-3.10 (m, 2H), 2.5-2.38 (m, 2H), 2.2-1.85 (m, 3H), 1.70-1.15 ( m, 10H), 1.13-0.92 (m, 13H), 0.73 (s, 3H). beige 16 377.5 powder 99 378.2 10.39 (s, 1H), 6.37 (s, 1H (C7)), 4.70 (s, 1H), 4.45-4.36 (m, 1H), 4.28-4.26 (m, 1H), 3.78- 3.70 (m, 1H), 3.67- 3.55 (m, 1H), 3.2-3.1 (m, 1H), 2.88-2.78 (m, 1H), 2.31-2.00 (m, 6H), 1.91-1.50 (m, 7H). ), 1.49-1.19 (m, 3H), 0.71 (s, 3H), 0.46 (s, 3H). beige 17 359.5 powder 99 360.2 10.68 (s, 1H), 6.11 (s, 1H), 5.73 (s, 1H), 4.40-4.30 (m, 1H), 4.55-4.50 (m, 1H), 3.75-3.67 (m , 1H), 3.65-3.52 (m, 1H), 3.20-3.12 (m, 1H), 3.13-2.95 (m, 1H), 2.76-2.60 (m, 1H), 2.27-2.08 (m, 5H), 1.75. -1.18 (m, 8H), 0.75-0.65 (m, 6H). beige 18 388.5 powder 99 389.2 10.53 (s, 1H), 6.09 (s, 1H), 5.04 (s, 1H), 4.37 (d, 1H), 4.30-4.26 (m, 1H), 3.77-3.67 (m, 4H) ), 3.65-3.55 (m, 1H), 3.15-3.03 (m, 1H), 2.80-2.65 (m, 2H), 2.25-2.12 (m, 1H), 2.05-1.99 (m, 1H), 1.79 (s). , 3H), 1.74-1.20 (m, 8H), 0.76-0.66 (m, 6H), white 21 460.6 powder 9 461.3 10.35 (s, 1H), 6.38 (s, 1H), 5.39-5.27 (m, 1H) , 4.58 (s, 1H), 4.49-4.27 (m, 1H), 4.25-4.22 (m, 1H), 3.74 (s, 1H), white 99 3.65-3.55 (m, 1H), 2.96-2.77 (m, 2H), 2.3-1.22 (m, 24H), 0.72 (s, 3H), 0.49 (s, 3H). LCMS purity, UV at 254 nm. Example 3: Scheme C; Preparation of Derivative No. 23: (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (N-ethoxy-C-methyl-carbonimidoyl) -2,3,14-trihydroxy-10,13-dimethyl -2,3,4,5,9,11,12,15,16,17-Decahydro-1Hcyclopenta [a] phenanthrene-6-one HCl HO HO HO Poststerone Product No. 23.
[0032] Following the same procedure as that described in step 3 of Scheme A, 64 mg of white powder (Yield: 22%) of (25.3R, 5R, 10R, 13R, 14S, 17S) (N- ethoxy-C-methyl-carbonimidoyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [ a] phenanthrene-6-one were prepared from poststerone (obtained by oxidative cleavage of the 20-hydroxyecdysone chain according to the same procedure as described in step 2 of scheme B). LC-MS: m / z = 406.2 (MH +) UV purity at 254 nm = 93%. 1H NMR (300 MHz, CD3OD) δ 5.82 (s, 1H (C7)), 4.04 (q, 2H), 3.97-3.92 (m, 1H), 3.89-3.80 (m, 1H), 3.22-3.10 (m, 1H), 3.04 (t, 1H), 2.43-1.55 (m, 15H), 1.45-1.37 (m, 1H), 1.21 (t, 3H), 0.96 (s, 3H), 0.64 (s, 3H). Derivatives Nos. 24 to 36 were prepared according to the same scheme No. PM Appearance, MS MS m / z 1F1 NMR (300 MHz, DMSO-d5) 8 g / mol MH purified (%) 24 377.5 white powder 99 378.1 ( in CD3OD) 5.81 (s, 1H (C7)), 3.95 (s, 1H), 3.85-3.80 (m, 1H), 3.25-3.17 (m, 1H), 3.05 (t, 1H), 2.45-1.55 (m.p. m, 15H), 1.47-1.39 (m, 1H), 0.96 (s, 3H), 0.63 (s, 3H). 391.5 white powder 95 392.2 (in CD3OD) 5.81 (s, 1H (C7)), 3.95 (s, 1H), 3.88-3.75 (m, 4H), 3.23-3.12 (m, 1H), 3.03 (t, 1H), 2.41-1.55 (m, 15H), 1.45-1.39 (m, 1H), 0.96 (s, 3H), 0.63 (s, 3H). 26 435.5 brown powder 99 436.2 (DMSO + D20) 8.66 (s, 1H (C7)), 4.41 (s, 1H), 3.77 (s, 1H), 3.68-3.58 (m, 1H), 3.03-2.96 (m.p. , 1H), 2.92-2.84 (m, 1H), 2.23-1.21 (m, 16H), 0.8 (s, 3H), 0.47 (s, 3H). 497.6 white powder 92 498.2 7.30-7.24 (m, 2H), 6.94-6.92 (m, 3H), 5.65 (s, 1H (C7)), 4.95 (s, 1H), 4.50-4.40 (m, 2H), 4.29-4.25 (m, 2H), 4.18-4.12 (m, 2H), 3.78-3.74 (m, 1H), 3.63-3.57 (m, 1H), 3.15-2.80 (m, 2H), 2.25-1.1 (m. , 16H), 0.82 (s, 3H), 0.49 (s, 3H). 13 C NMR (75 MHz, DMSO-D6) 202.8 (C6), 177.8, 164.1, 158.6, 157.8, 129.6, 120.7, 114.5, 82.5, 51.2, 47.2, 45.7, 30.5, 21.1, 16.2, 6.2. 28 431.6 white powder 99 432.2 5.87-5.73 (m, 1H), 5.65 (s, 1H (C7)), 5.1-5 (m, 2H), 4.94 (s, 1H), 4.49 (d, 1H), 4.41- 4.39 (m, 1H), 4.05-3.95 (m, 2H), 3.77 (s, 1H), 3.66-3.58 (m, 1H), 3.1-2.98 (m, 1H), 2.94 (t, 1H), 2.4- 1.4 (m, 17H), 1.32-1.22 (m, 1H), 0.83 (s, 3H), 0.51 (s, 3H). 13 C NMR (75 MHz, DMSO-d 6) 202.8 (C6), 164.2, 156.9, 116.6, 82.5, 71.7, 47.2, 37.7, 33.5, 31.6, 21.1. 23 435.6 white powder 99 436.2 5.65 (s, 1H (C7)), 4.94 (s, 1H), 4.50-4.48 (m, 1H), 4.424.39 (m, 1H), 4.10-4.02 (m, 2H), 3.8-3.72 (m, 1H), 3.7- 3.55 (m, 1H), 3.52-3.48 (m, 2H), 3.24 (s, 3H), 3.08-3 (m, 1H), 2.94 (t, 1H), 2.28-2.03 (m, 3H), 1.92-1.42 (m, 12H), 1.34-1.20 (m, 1H), 0.83 (s, 3H), 0.51 (s, 3H). 445.6 beige powder 90 446.2 5.65 (s, 1H (C7)), 5.37-5.29 (m, 1H), 4.92 (s, 1H), 4.51-4.35 (m, 3H), 3.81-3.74 (m, 1H), 3.68-3.56 (m, 1H), 3.08-2.85 (m, 2H), 2.25-1.18 (m, 23H), 0.83 (s, 3H), 0.50 (s, 3H). 31 490.6 white powder 90 491.3 5.66 (s, 1H (C7)), 4.97 (s, 1H), 4.52-4.3 (m, 4H), 3.95- 3.55 (m, 7H), 3.1-2.87 (m, 4H), 2.25-1.18 (m, 19H), 0.83 (s, 3H), 0.52 (s, 3H). White powder 9 477.3 5.65 (s, 1H (C7)), 4.98 (s, 1H), 4.52 (d, 1H), 4.44-4.40 (m, 1H), 4.39-4 (m, 2H), 3.77 ( s, 1H), 3.70-3.54 (m, 1H), 3.1-2.85 (m, 6H), 2.28-2.02 (m, 4H), 1.9-0.92 (m, 21H), 0.83 (s, 3H), 0.52 (m, 1H), s, 3H). Orange powder 99 480.2 7.34-7.24 (m, 2H), 6.97-6.89 (m, 3H), 6.14-6.08 (m, 1H), 5.57 (s, 1H), 4.48-4.15 (m, 6H), 3.66 (s, 1H), 3.47- 3.37 (m, 1H), 2.35-1.95 (m, 4H), 1.92-1.65 (m, 8H), 1.62-1.43 (m, 4H), 0.97-0.94 (m, 6H); ). White powder 96 509.2 8.57 (s, 1H), 6.35 (s, 1H (C7)), 4.72 (s, 1H), 4.47 (s, 4H), 3.74 (m, 3H), 2.28-1.25 (m, 19H), 0.75-0.65 (m, 3H), 0.5 (s, 3H). White powder 979 449.2 5.66 (s, 1H (C7)), 4.97 (s, 1H), 4.55-4.25 (m, 4H), 3.77 (s, 1H), 3.68-3.56 (m, 1H), 3.12 -2.9 (m, 3H), 2.77 (s, 6H), 2.28-2.05 (m, 4H), 1.9-1.4 (m, 12H), 1.34-1.21 (m, 1H), 0.84 (s, 3H), 0.54. (s, 3H). 36 474.6 white powder 96 9 475.2 (in D20) 8 5.95 (s, 1H (C7)), 4.38-4.31 (m, 2H), 4.06-3.91 (m, 2H), 3.74-3.60 (m, 2H), 3.55 -3.48 (m, 2H), 3.20-3.05 (m, 2H), 3.03-2.93 (m, 1H), 2.35-1.55 (m, 20H), 1.41-1.28 (m, 1H), 0.95 (s, 3H); 0.62 (s, 3H). LCMS purity, UV at 254 nm. Example 4: Scheme D; Preparation of Derivative No. 37: N- (2,2-difluoroethyl) -N- (1-g2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-6-methoxyimino 10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthylguran-2-carboxamide 302 1 3 1 8 53 N, ...., Product 37 Step 1: Preparation of product 39: g2S, 3R, 5ReE, 10R, 13R, 14S, 17S) - 1711- (2,2-difluoroethylamino) ethyl-6-methoxyimino-10 1,3-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopentafflphenanthrene 2,3,3-triol]. Product No. 14. Product No. 39. 180 mg (0.46 mmol) of product No. 14 [1 - [(2S, 3R, 5R, 6E, 10R, 13R) 14S, 17S) - 2,3,14-trihydroxy-6-methoxyimino-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [ a] phenanthrene-17-yl] ethanone] obtained in step 2b of method B are solubilized in 5 mL of methanol and 0.21 mL (2.76 mmol) of 2,2-difluoroethanamine are added to the reaction medium. The pH of the solution is adjusted to 6 using the sufficient amount of concentrated acetic acid. Then 31.8 mg (0.506 mmol) of sodium cyanoborohydride are added portionwise and the suspension obtained is heated under reflux for 20 h. The solvent is evaporated and the residue obtained is taken up in 20 ml of water and the pH is adjusted to 8 with a saturated solution of sodium bicarbonate. This aqueous phase is extracted with twice 15 ml of butanol and the butanol phase is dried over sulphate, filtered and evaporated to give a yellow solid, which, taken up in 30 ml of isopropyl ether and filtered, gives Drying 134 mg (Yield: 62%) of (2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -17 [1- (2,2-difluoroethylamino) ethyl] -6-methoxyimino-10,13 dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-2,3,14-triol as a yellow powder. LC-MS: m / z = 457.4 (MEI +) UV purity at 254 nm = 97%. 1H NMR (300MHz, DMSO-d6) b 6.30-6.23 (m, 1H), 5.95-5.70 (m, 1H), 4.434.25 (m, 3H), 3.72 (s, 3H), 3.65-3.55 (m. , 1H), 3.42-3.32 (m, 1H), 2.88-2.76 (m, 2H), 2.29-2.23 (m, 1H), 1.99-1.15 (m, 16H), 1.05-0.82 (m, 3H), 0.73. (s, 3H), 0.61-0.53 (m, 3H). Step 2: Preparation of Derivative No. 37 Is / - (2,2-difluoroethyl) -N- (1- g2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy- 6-methoxyimino-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopentafflphenanthrene-17-ylethylguran-2-carboxamide HO O HO O Cl HO Product No. 39. Product No. 37. 134 mg, (0.285 mmol) (2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -17- [1- (2,2-difluoroethylamino)) Ethyl-6-methoxyimino-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-2,3,14-triol are solubilized in 2 mL of THF and 52 mg (0.854 mmol) of sodium bicarbonate are added to the reaction medium under an Argon atmosphere. 30 μl (0.299 mmol) of furoyl chloride are added and the reaction mixture is stirred for 20 h at 20 ° C. The solution is then poured into 5 ml of water and extracted twice with 10 ml of butanol. The butanolic phase is evaporated to give 118 mg of purified solid by flash chromatography on silica gel cartridge (95/5 dichloromethane / MeOH) to give 100 mg of white powder (yield: 60%). derivative no. 37: N- (2,2-difluoroethyl) -N41-5 [(2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-6-methoxyimino-10 13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] fluorane-2-carboxam ide. LC-MS: m / z = 551.3 (MH +) UV purity at 254 nm = 93%. 1H NMR (300 MHz, DMSO-d6) δ 7.87 (s, 1H), 7.03 (s, 1H), 6.64 (s, 1H), 6.25 (s, 1H), 4.58 (d, 1H), 4.43-4.27 (m, 3H), 3.95-3.83 (m, 1H), 3.75-3.65 (m, 4H), 3.63-3.49 (m, 2H), 2.85-2.68 (m, 1H), 2.31-2.18 (m. , 1H), 2.01-1 (m, 17H), 0.73-0.15 (m, 6H). Derivatives 38 and 40 were prepared according to the same scheme. No. PM g / mol Apparent, MS m / z MH 1H NMR (300 MHz, DMSO-d5) 6 Purest. (%) 38 550.7 white powder 93 551.5 6.27 (s, 1H (C7)), 4.55-4.22 (m, 4H), 3.78-3.67 (m, 4H), 3.62-3.54 (m, 1H), 3.32-3.22 ( m, 6H), 2.952.70 (m, 2H), 2.30-2.19 (m, 1H), 2-0.9 (m, 25H), 0.79-0.40 (m, 6H). 40 480.6 beige powder 99 481.4 6.35-6.24 (m, 1H), 4.48-4.25 (m, 4H), 3.71 (s, 3H), 3.65-3.55 (m, 1H), 3.40-3.20 (m, 7H), 2.88 -2.76 (m, 1H), 2.75-2.66 (m, 1H), 2.29-2.22 (m, 1H), 2- 1.15 (m, 15H), 1.05-0.76 (m, 4H), 0.73 (s, 3H); , 0.61-0.54 (m, 3H). 1 LCMS UV purity at 254 nm. Example 5: Scheme E; Preparation of Derivative No. 41: 2-Methoxy-N- (2-methoxyethyl) -N- (1-g2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10, 13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-ygthyllacetamide 302 1 3 1 8 56 HO HO Product 41 Step 1: Preparation of Derivative No. 42 (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-1711- (2-methoxyethylamino) ethyl] -10,13-dimethyl-2-yl , 3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopentafflphenanthrene-6-one HO HO HO. 1-12N0 / Poststerone 5 g (13.8 mmol) of poststerone (obtained by oxidative cleavage of the chain of 20-hydroxyecdysone according to the same procedure as that described in step 2 of scheme B) are solubilized in 250 mL of methanol and 7.2 mL (83 mmol) of 2-methoxyethylamine are added dropwise. The pH of the solution is then brought to pH 6 by addition of concentrated acetic acid and 250 mL of THF are added. 0.954 g of sodium cyanoborohydride are added in portions and the reaction mixture is refluxed for 20 h. The solvents are evaporated and the crude obtained is taken up in 100 ml of water and the pH is adjusted to 8 by addition of a saturated solution of sodium bicarbonate. The medium is extracted three times with 80 ml of butanol and the butanol phase is evaporated to give a brown foam which, taken up with 5 ml of ethyl acetate gives after filtration and drying 3.32 g (yield: 57%) of Derivative No. 42: (28,3R, 5R, 10R, 13R, 148,178) -2,3,14-Trihydroxy-17-N- (2-methoxyethylamino) ethyl] -10,13-dimethyl-2,3,4 , 5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one in the form of gray powder.
[0033] LC-MS: m / z = 422.2 (MH +) UV purity at 254 nm = 95%. 1 H NMR (300 MHz, DMSO-d 6) δ 5.70-5.60 (m, 1H (C 7)), 4.80-4.62 (m, 1H), 4.55-4.47 (m, 1H), 4.43-4.35 (m, 1H), 3.78-3.70 (m, 2H), 3.68-3.50 (m, 3H), 3.30-3.18 (m, 5H), 3.10-2.91 (m, 1H), 2.30-0.9 (m, 18H), 0.82 (s, 3H). ), 0.59 (s, 3H). 13 C NMR (75 MHz, DMSO-d 6) 202.9 (C6), 120.5, 82.9, 66.7, 58.1, 46.2, 37.8, 30.5, 23.9, 6.2. Step 2: Preparation of Derivative No. 41: 2-methoxy-N- (2-methoxyethyl) -N- (1-g2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy- 10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopentafflphenanthrene-17-ylethylacetamide According to the same procedure as step 2 of Example 5, 89 mg (Yield: 58%) of 2-methoxy-N- (2-methoxyethyl) -N41- [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy 10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] acetamide were obtained under orange powder form from derivative No. 42.
[0034] LC-MS: m / z = 494.4 (MH +) UV purity at 254 nm = 94%. 1 H NMR (300 MHz, DMSO-d 6) δ 5.63 (s, 1H (C7)), 4.88-4.7 (m, 1H), 4.5-4.35 (m, 2H), 4.2-3.9 (m, 2H), 3.76 (s, 1H), 3.68-3.52 (m, 1H), 3.5-3.3 (m, 4H), 3.28-3.18 (m, 6H), 3.08-2.9 (m, 1H), 2.3-0.95 (m, 18H); 0.88-0.75 (m, 3H), 0.7-0.42 (m, 3H).
[0035] Derivatives Nos. 43 to 75 were prepared according to the same scheme: ## EQU1 ## Apparent Purity (%) MS m / z MH 1H NMR (300 MHz, DMSO-d5) 6 g / mol 43 454.6 white powder 91 455.2 8.54-8.38 (m, 2H), 7.75-7.68 (m, 1H), 7.35-7.28 (m, 1H), 5.60 (s, 1H (C7)), 4.63 (s, 1H), 4.42 (d, 1H), 4.37-4.34 (m, 1H), 3.88-3.48 (m, 5H), 3.10-2.85 (m, 1H), 2.25-1.05 (m, 15H), 1.03 (d, 3H), 0.83 (s, 3H), 0.52 (s, 3H). 44 476.7 white powder 91 477.3 5.67-5.60 (m, 1H (C7)), 4.98-4.40 (m, 3H), 3.76 (s, 1H), 3.68-3.45 (m, 5H), 3.10-2.78 (m, 2H) ), 2.45-0.95 (m, 26H), 0.83 (s, 3H), 0.64-0.58 (m, 3H). 45 403.6 white powder 85 404.2 5.73-5.60 (m, 1H (C7)), 4.80-4.62 (m, 1H), 4.56-4.50 (m, 1H), 4.46-4.38 (m, 1H), 3.77 (s, 1H) ), 3.68-3.53 (m, 2H), 3.53-3.45 (m, 1H), 3.10-2.85 (m, 1H), 2.30-0.98 (m, 22H), 0.84 (s, 3H), 0.65-0.5 (m. , 3H). 46 447.6 yellow oil 92 448.2 5.69-5.61 (m, 1H (C7)), 4.92-4.75 (m, 1H), 4.48-4.33 (m, 2H), 4.18-3.55 (m, 4H), 3.1-2.7 (m , 3H), 2.3-1 (m, 24H), 0.85 (s, 3H), 0.65-0.55 (m, 3H). 13C NMR (75 MHz, DMSO-d 5) 202.8 (C6), 163.9, 120.5, 82.8, 67.5, 66.7, 50.1, 46.2, 37.7, 36.6, 33.3, 28.9, 25.2, 23.9, 20, 15.2. 515.7 white powder 93 516.1 5.68-5.60 (m, 1H (C7)), 4.87-4.65 (m, 1H), 4.48-4.35 (m, 2H), 4.08-3.88 (m, 1H), 3.81-3.50 (m , 4H), 3.353.25 (m, 2H), 3.08-2.9 (m, 1H), 2.3-0.95 (m, 23H), 0.90.4 (m, 10H). 48 501.7 white powder 97 502.4 6.85-6.65 (m, 1H), 6.20-5.9 (m, 1H), 5.70-5.50 (m, 2H), 4.85-4.70 (m, 1H), 4.48-4.30 (m, 2H) , 4.2-3.8 (m, 1H), 3.77-3.70 (m, 2H), 3.68-3.40 (m, 3H), 3.10-2.85 (m, 1H), 2.27-1 (m, 23H), 0.85-0.75 ( m, 3H), 0.70-0.46 (m, 3H). 49 515.6 white powder 99 516.3 7.82 (s, 1H), 6.93 (s, 1H), 6.60 (s, 1H), 5.65-5.55 (m, 1H), 4.84 (s, 1H), 4.48-4.35 (m, 2H) ), 4.30-4.20 (m, 1H), 3.77-3.33 (m, 3H), 3.32-3.12 (m, 5H), 3.10-2.85 (m, 1H), 2.25-1 (m, 18H), 0.84-0.76; (m, 3H), 0.74-0.17 (m, 3H). 50 503.7 mauve powder 99 504.3 5.62 (s, 1H (C7)), 4.88-4.65 (m, 1H), 4.47-4.33 (m, 2H), 4.08-3.85 (m, 1H), 3.8-3.5 (m, 4H) ), 3.08-2.9 (m, 2H), 2.3-0.9 (m, 28H), 0.88-0.72 (m, 3H), 0.69-0.4 (m, 3H). 51 51.7.7 white powder 94 520.4 5.63 (s, 1H (C7)), 4.88-4.7 (m, 1H), 4.45-4.35 (m, 2H), 3.75 (s, 1H), 3.68-3.52 (m, 1H), 3.52-3.35 (m, 2H), 3.27-3.21 (m, 5H), 3.08-2.9 (m, 1H), 2.26-0.86 (m, 23H), 0.87-0.72 (m, 9H), 0.70-0.47 (m. , 3H). 52 503.7 orange powder 99 504.4 5.91-5.75 (m, 1H), 5.68-5.60 (m, 1H (C7)), 5.07-4.89 (m, 2H), 4.83-4.65 (m, 1H), 4.45-4.28 (m , 2H), 3.76 (s, 1H), 3.68-3.52 (m, 1H), 3.46-3.35 (m, 2H), 3.30-3.15 (m, 5H), 3.08-2.09 (m, 1H), 2.47-0.92. (m, 22H), 0.90-0.77 (m, 3H), 0.7-0.45 (m, 3H). 53 531.7 white powder 99 532.4 7.76-7.70 (m, 1H), 7.39-7.32 (m, 1H), 7.12-7.08 (m, 1H), 5.59 (s, 1H (C7)), 4.81 (s, 1H), 4.43-4.22 (m, 2H), 3.78-3.53 (m, 2H), 3.52-3.32 (m, 2H), 3.28-3.08 (m, 5H), 3.05-2.85 (m, 1H), 2.25-1.15 (m. , 18H), 0.83-0.76 (m, 3H), 0.70-0.15 (m, 3H). 54 475.6 white powder 99 476.3 5.63 (s, 1H (C7)), 4.78-4.68 (m, 1H), 4.45-4.32 (m, 2H), 4.28-4.08 (m, 2H), 3.8-3.7 (m, 1H) ), 3.68-3.54 (m, 1H), 3.28-3.18 (m, 5H), 3.05-2.85 (m, 1H), 2.25-1.09 (m, 17H), 0.88-0.7 (m, 7H), 0.68-0.52 (m, 3H). White powder 99.460.3 5.63 (s, 1H (C7)), 4.78-4.52 (m, 1H), 4.48-4.32 (m, 2H), 3.76 (s, 1H), 3.68-3.54 (m, 1H), 3.05-2.85 (m, 1H), 2.48-1.08 (m, 21H), 1.02-0.92 (m, 3H), 0.90-0.69 (m, 7H), 0.68-0.52 (m, 3H). White powder 99 533.3 7.89 (d, 2H), 7.60 (d, 2H), 5.66 (s, 1H (C7)), 4.81 (s, 1H), 4.49-4.32 (m, 2H), 3.76 (s, 1H), 3.68-3.54 (m, 1H), 3.05-2.85 (m, 1H), 2.80-2.72 (m, 1H), 2.27-1.18 (m, 18H), 0.85 (s, 3H), 0.73-0.22 ( m, 7H). 57 534.7 white powder 99 535.3 5.62 (s, 1H (C7)), 4.78 (s, 1H), 4.46 (d, 1H), 4.39-4.35 (m, 1H), 3.75 (s, 1H), 3.68-3.4 ( m, 5H), 3.28-3.13 (m, 5H), 3.10-2.82 (m, 7H), 2.4-1.1 (m, 18H), 0.88-0.75 (m, 3H), 0.65-0.51 (m, 3H). 58 508.7 pink powder 99 509.4 8.68-8.55 (m, 2H), 7.85-7.77 (m, 1H), 7.5-7.35 (m, 1H), 5.66 (s, 1H (C7)), 4.82 (s, 1H), 4.48-4.30 (m, 2H), 3.76 (s, 1H), 3.68-3.54 (m, 1H), 3.12-2.78 (m, 2H), 2.25-1.15 (m, 18H), 0.88-0.18 (m, 10H). ). 59 537.7 white powder 92 538.8 7.42 (t, 2H), 6.98-6.85 (m, 2H), 5.69-5.62 (m, 1H (C7)), 4.85-4.79 (m, 1H), 4.49-4.35 (m, 2H) ), 3.78-3.73 (m, 4H), 3.67-3.51 (m, 1H), 3.10-2.87 (m, 2H), 2.27-1.20 (m, 18H), 0.87-0.83 (m, 3H), 0.74-0.18; (m, 7H). 60 545.7 white powder 99 546.2 7.83 (s, 1H), 6.94 (s, 1H), 6.61 (s, 1H), 5.67-5.57 (m, 1H (C7)), 4.84 (s, 1H), 4.63-4.17 ( m, 4H), 3.75 (s, 1H), 3.67-3.51 (m, 2H), 3.29-3.24 (m, 6H), 3.10-2.87 (m, 1H), 2.25-1.03 (m, 18H), 0.85-. 0.74 (m, 3H), 0.70-0.10 (m, 3H). 61 505.7 white powder 99 506.2 6.85-6.65 (m, 1H), 6.20-6.00 (m, 1H), 5.70-5.62 (m, 2H), 4.87-4.70 (m, 1H), 4.48-4.36 (m, 2H) , 3.75 (s, 1H), 3.65-3.42 (m, 2H), 3.29-3.24 (m, 6H), 3.10-2.87 (m, 2H), 2.27-0.98 (m, 19H), 0.86-0.78 (m, 3H), 0.700.46 (m, 3H). 62 519.7 white powder 99 520.3 5.63 (s, 1H (C7)), 4.9-4.65 (m, 1H), 4.48-4.36 (m, 2H), 4.25-3.85 (m, 3H), 3.82-3.70 (m, 2H) ), 3.68-3.56 (m, 2H), 3.29-3.23 (m, 3H), 3.08-2.93 (m, 2H), 2.28-1.02 (m, 23H), 0.86-0.79 (m, 3H), 0.66-0.47 (m, 3H). 63 541.7 powder 97 542.2 7.84-7.75 (m, 1H), 6.94-6.86 (m, 1H), 6.62-6.57 (m, white 1H), 5.64-5.53 (m, 1H (C7)), 4.84 (s, 1H ), 4.48-4.36 (m, 2H), 4.34-3.80 (m, 2H), 3.78-3.50 (m, 5H), 3.08-2.93 (m, 2H), 2.24-1.05 (m, 21H), 0.85-0.74; (m, 3H), 0.730.16 (m, 3H). 64 white powder 97 not 7.77-7.71 (m, 1H), 7.41-7.30 (m, 1H), 7.13-7.09 (m, 1H), 5.70-5.56 (m, 1H (C7)), 4.84 (s, 1H), 4.62-4.17 (m, 4H), 3.74-3.51 (m, 3H), 3.32-3.26 (m, 6H), 3.08-2.93 (m, 2H), 2.24-1.15 (m, 17H), 0.85-. 0.70 (m, 3H), 0.680.17 (m, 3H). white powder mass 65 519.7 white powder 97 520.2 5.68-5.60 (m, 1H (C7)), 4.86-4.70 (m, 1H), 4.56-4.34 (m, 3H), 3.75 (s, 1H), 3.67-3.53 (m, 2H), 3.30-3.23 (m, 6H), 3.10-2.9 (m, 2H), 2.23-0.93 (m, 19H), 0.87-0.77 (m, 3H), 0.75-0.40 (m, 7H). 66 521.7 white powder 94 522.3 5.63 (s, 1H (C7)), 4.86-4.70 (m, 1H), 4.55-4.34 (m, 3H), 3.76 (s, 1H), 3.68-3.53 (m, 1H), 3.35-3.20 (m, 6H), 3.10-2.87 (m, 2H), 2.29-0.9 (m, 26H), 0.88-0.72 (m, 3H), 0.69-0.41 (m, 3H). 67 521.6 white powder 99 522.1 7.87 (s, 1H), 7.07-7.01 (m, 1H), 6.67-6.61 (m, 1H), 5.63-5.54 (m, 1H (C7)), 4.88-4.84 (m, 1H) ), 4.45-4.32 (m, 3H), 4.01-3.35 (m, 3H), 3.10-2.85 (m, 1H), 2.251.05 (m, 19H), 0.80-0.76 (m, 3H), 0.70-0.17 (m, 3H). 68 495.6 white powder 99 496.2 6.43-5.87 (m, 1H), 5.67-5.63 (m, 1H (C7)), 4.88-4.70 (m, 1H), 4.47-4.25 (m, 3H), 3.80-3.52 (m , 3H), 3.10-2.85 (m, 1H), 2.30-0.95 (m, 19H), 0.90-0.46 (m, 10H). 69 481.6 white powder 99 482.1 6.95-6.68 (m, 1H), 6.38-5.90 (m, 2H), 5.78-5.61 (m, 2H), 4.88-4.70 (m, 1H), 4.47-4.34 (m, 2H) , 4.15-3.85 (m, 1H), 3.83-3.74 (m, 2H), 3.68-3.5 (m, 1H), 3.10-2.85 (m, 1H), 2.30-0.98 (m, 18H), 0.81-0.77 (m, 1H), m, 3H), 0.65 (s, 1H), 0.50 (s, 2H). 70 427.5 yellow powder 99 428.1 6.13-5.59 (m, 1H), 5.61 (s, 1H (C7)), 4.63 (s, 1H), 4.44 (s, 1H), 4.35 (s, 1H), 3.76 (s, 1H), 3.68-3.53 (m, 1H), 3.10-2.85 (m, 1H), 2.30-2.15 (m, 2H), 2-1.1 (m, 16H), 0.97 (s, 3H), 0.84 (s, 3H), 0.61 (s, 3H). 71 527.6 yellow powder 99 528.2 6.13-5.71 (m, 1H), 5.67 (s, 1H (C7)), 5.03-4.99 (m, 1H), 4.77 (s, 1H), 4.70-4.57 (m, 1H), 3.99 (s, 1H), 3.12-3 (m, 1H), 2.92-2.70 (m, 2H), 2.30-2.24 (m, 1H), 2.10-1.18 (m, 24H), 1.08-0.96 (m, 3H). ), 0.87 (s, 3H), 0.57 (s, 3H). Yellow powder 99 527.2 8.50-8.37 (m, 2H), 7.64-7.60 (m, 1H), 7.45-7.28 (m, 1H), 5.67-5.62 (m, 1H (C7)), 4.95-4 (m.p. , 6H), 3.83-3.50 (m, 3H), 3.35-3.24 (m, 3H), 3.12-2.85 (m, 1H), 2.250.80 (m, 18H), 0.84 (s, 3H), 0.70 (m. , 3H). 73 548.7 yellow powder 99 549.2 8.55-8.32 (m, 2H), 7.88-7.80 (m, 1H), 7.75-7.60 (m, 1H), 7.34-7.25 (m, 1H), 7.05-6.80 (m, 1H) , 6.66-6.40 (m, 1H), 5.62 (s, 1H (C7)), 4.90-4.70 (m, 2H), 4.49-4.27 (m, 3H), 3.76 (s, 1H), 3.69-3.53 (m.p. , 1H), 3.12-2.85 (m, 1H), 2.27-0.95 (m, 18H), 0.84-0.73 (m, 3H), 0.65-0.19 (m, 3H). Yellow powder 96 523.2 8.60-8.30 (m, 2H), 7.73-7.5 (m, 1H), 7.41-7.25 (m, 1H), 5.67-5.62 (m, 1H (C7)), 4.92-4.75 (m.p. , 2H), 4.5-4.3 (m, 2H), 3.76 (s, 1H), 3.69-3.53 (m, 1H), 3.12-2.89 (m, 1H), 2.28-0.96 (m, 20H), 0.97-0.40. (m, 10H). 75 491.7 white powder 99 492.2 5.68-5.60 (m, 1H (C7)), 4.84 (s, 1H), 4.82-4.65 (m, 1H), 4.46-4.32 (m, 2H), 3.76 (s, 1H), 3.68-3.52 (m, 2H), 3.48-3.38 (m, 1H), 3.23-3.19 (m, 5H), 3.20-2.71 (m, 3H), 2.29-0.90 (m, 22H), 0.80-0.77 (m.p. , 3H), 0.71-0.45 (m, 3H). LCMS purity, UV at 254 nm. Example 6: Scheme F; Preparation of Derivative No. 76: (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-1711- (2-methoxyethyl (methyl) amino) ethyl] -10,13-dimethyl 2,3,4,5,9,11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one HO O H HO HO Product 42 Product 76 155 mg (0.368 mmol) ) (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-17- [1- (2-methoxyethylamino) ethyl] -10,13-dimethyl-2,3,4 , 5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one prepared according to the technique described in step 1 of example 5 are solubilized in 2.5 ml DMF and 61.8 mg (0.735 mmol) of sodium bicarbonate are added to the reaction medium as well as 0.034 ml (0.552 mmol) of iodomethane. The suspension obtained is stirred at 20 ° C. for 20 hours. The solution is then poured into 15 ml of water and extracted three times with 15 ml of butanol. The butanol phase is evaporated to give 220 mg of purified powder by flash chromatography on a silica gel cartridge (dichloromethane / MeOH, 95/5) to give 40 mg of white powder (yield: 25%) of the derivative n: (2S, 3 R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-1711- (2-methoxyethyl (methylhamino) ethyl] -10,13-dimethyl-2,3,4,5, 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one in the form of a white powder LC-MS: m / z = 436.3 (MH +) UV purity at 254 nm = 99% 1H NMR (300 MHz, DMSO-d6) b 5.61 (s, 1H (C7)), 4.64 (s, 1H), 4.47-4.34 (m, 2H), 3.75 (s, 1H), 3.67- 3.50 (m, 1H), 3.25-3.16 (m, 5H), 3.05-2.85 (m, 1H), 2.27-1.15 (m, 20H), 0.90-0.70 (m, 6H), 0.59 (s, 3H). Derivatives Nos. 77 to 80 were prepared according to the same scheme No. PM Appearance, MS m / z 1H NMR (300 MHz, DMSO-d5) 6 g / mol Purest I + (%) MH 77 461.6 white powder 86 462.3 5.68-5.58 (m, 1H (C7)), 4.50-4.30 (m, 2H), 3.85-3.50 (m, 4H), 3.10-2.90 (m, 2H), 2.25-1.10 (m, 25H), 0.90-. 0.75 (m, 6H), 0.65-0.45 (m, 3H), 78 417.6 white powder 99 418.3 5.63-5.58 (m, 1H (C7)), 4.65 (s, 1H), 4.42 (d, 1H), 4.38-4.33 (m, 1H), 3.75 (s, 1H), 3.67-3.53 (m, 1H), 3.04-2.90 (m, 1H), 2.96-2.67 (m, 1H), 2.23-1.12 (m, 18H), 0.89 (d, 3H), 0.82 (s, 3H), 0.57-0.15 (m, 7H). 79 465.6 beige powder 94 466.2 5.67-5.57 (m, 1H (C7)), 4.70-4.64 (m, 1H), 4.48-4.33 (m, 3H), 3.76 (s, 1H), 3.65-3.55 (m, 1H) ), 3.27-3.22 (m, 6H), 3.05-2.85 (m, 1H), 2.26-1.10 (m, 20H), 0.87-0.73 (m, 6H), 0.64-0.47 (m, 3H). 80 441.6 yellow powder 99 442.1 6.25-5.75 (m, 1H), 5.65-5.61 (m, 1H (C7)), 4.71-4.66 (m, 1H), 4.48-4.40 (m, 1H), 4.39-4.35 (m , 1H), 3.76 (s, 1H), 3.65-3.55 (m, 1H), 3.05-2.85 (m, 1H), 2.76-2.70 (m, 1H), 2.28-1.15 (m, 19H), 0.90-0.80. (m, 6H), 0.620.46 (m, 3H). 1 LCMS purity, UV at 254 nm Example 7: Scheme G; Preparation of Derivative No. 81: (25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-10,13-dimethyl-1742-morpholinoacetyl (-2,3,4,5,9), 11,12,15,16,17-Decahydro-1H-cyclopentak] phenanthrene-6-one Step 1: Preparation of Derivative No. 102: (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (2-Bromoacetyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopentafflphenanthrene-6-one 1 g (2.76 mmol) of poststerone (obtained by oxidative cleavage of the chain of 20-hydroxyecdysone according to the same procedure as that described in step 2 of scheme B) are solubilized in 20 ml of methanol. The solution is cooled to 0 ° C. and 0.284 ml (5.52 mmol of bromine are added dropwise and the reaction medium is stirred for 1 hour at this temperature and then left at ambient temperature for 16 hours. 50 ml of a saturated solution of sodium bicarbonate and extracted three times with 100 ml of ethyl acetate The organic phases are washed with 50 ml of saturated sodium bicarbonate solution, then with salt water, dried over sulphate of sodium, filtered and the solvent evaporated to give 833 mg of the product, which, taken up in 30 ml of dichloromethane, gave after filtration and desiccation 412 mg ( Yield: 31%) of compound no. 102: 2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (2-bromoacetyl) -2,3,14-trihydroxy-10,13-dimethyl-2, 3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one in the form of a yellow powder. LC-MS: m / z = 443.1 (MH +) UV purity at 254 nm = 91%. 1H NMR (300 MHz, DMSO-d6) 5.69-5.63 (m, 1H (C7)), 5.08 (s, 1H), 4.424.35 (m, 3H), 4.33-4.22 (m, 1H), 3.77 (s, 1H), 3.66-3.58 (m, 1H), 3.39 (t, 1H), 3.10-2.95 (m, 1H), 2.25-1.20 (m, 13H), 0.83 (s, 3H), 0.51 (s, 3H).
[0036] Step 2: Preparation of Derivative No. 81 (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-17- (2-morpholinoacetyl) -2,3 , 4,5,9,11,12,15,16,17-decahydro-1H-cyclopentafflphenanthren-6-one Product 81 50 mg (0.103 mmol) of 2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (2-bromoacetyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17 1-decahydro-1H-cyclopenta [a] phenanthrene-6-one are solubilized in 1 mL of DMF and 42.7 mg of potassium carbonate are added as well as 10.78 μL (0.124 mmol) of morpholine. After stirring for 18 h at 20 ° C., the reaction mixture is poured into 10 ml of water and this aqueous phase is extracted twice with 15 ml of butanol. The organic phase is evaporated to give 71 mg of purified powder by flash chromatography on a silica gel cartridge (90/10 dichloromethane / MeOH) to give 28 mg (yield: 60%) of derivative 81: (2S, 3 R, R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-17- (2-morpholinoacetyl) -2,3,4,5,9,11,12 , 15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one in the form of a white powder. LC-MS: m / z = 448.4 (MH +) UV purity at 254 nm = 99%. 1H NMR (300MHz, DMSO-d6) b 5.65 (s, 1H (C7)), 5.02 (s, 1H), 4.45 (d, 1H), 4.40-4.37 (m, 1H), 3.77 (s, 1H); , 3.68-3.53 (m, 5H), 3.34-3.24 (m, 4H), 3.082.95 (m, 1H), 2.45-1.17 (m, 16H), 0.82 (s, 3H), 0.48 (s, 3H). . Derivatives Nos. 82 to 94 were prepared according to the same scheme. No. PM g / mol Appearance, MS MS m / z 1 H NMR (300 MHz, DMSO-d5) 8 Purities + (%) MH 82 474.6 orange powder 99 475.3 5.65 (s, 1H (C7)), 5.03 (s, 1H), 4.49-4.38 (m, 2H), 3.77 (s, 1H), 3.68-3.53 (m, 1H), 3.3-3.1 (m, 4H), 3.08-2.95 (m, 1H), 2.9-2.45 (m, 1H), m, 6H), 2.28-0.92 (m, 19H), 0.82 (s, 3H), 0.48 (s, 3H). 83 475.6 white powder 99 476.6 5.65 (s, 1H (C7)), 5.01 (s, 1H), 4.45 (d, 1H), 4.41-4.38 (m, 1H), 3.77 (s, 1H), 3.7-3.48 ( m, 3H), 3.35-3.23 (m, 2H), 3.08-2.95 (m, 1H), 2.72-2.55 (m, 2H), 2.28-2 (m, 3H), 1.9-1.38 (m, 12H), 1.35-1.18 (m, 1H), 1.05-0.85 (m, 6H), 0.82 (s, 3H), 0.48 (s, 3H). 84 462.6 yellow powder 99 463.3 5.66 (s, 1H (C7)), 5.08 (s, 1H), 4.55-4.25 (m, 2H), 3.77 (s, 1H), 3.70-3.45 (m, 4H), 3.25- 2.90 (m, 5H), 2.80-2.60 (m, 6H), 2.33-1.15 (m, 16H), 0.83 (s, 3H), 0.50 (s, 3H). 85 479.6 yellow oil 99 480.3 5.65 (s, 1H (C7)), 5.01 (s, 1H), 4.48-4.37 (m, 3H), 3.77 (s, 1H), 3.70-3.52 (m, 1H), 3.25 ( s, 6H), 3.25-2.90 (m, 1H), 2.57-2.47 (m, 2H), 2.3-1.19 (m, 19H), 0.82 (s, 3H), 0.48 (s, 3H). 86 447.6 orange oil 99 448.2 5.67 (s, 1H (C7)), 5.44-5.39 (m, 1H), 5.14 (s, 1H), 4.5-4.15 (m, 5H), 3.77 (s, 1H), 3.68- 3.55 (m, 1H), 3.27-3.15 (m, 4H), 3.25-2.90 (m, 1H), 2.25-1.17 (m, 16H), 0.83 (s, 3H), 0.54 (s, 3H). 87 435.6 colorless oil 99 436.2 5.65 (s, 1H (C7)), 5.02 (s, 1H), 4.49-4.38 (m, 3H), 3.77 (s, 1H), 3.68-3.55 (m, 1H), 3.52- 3.36 (m, 2H), 3.30-3.18 (m, 2H), 3.25-2.95 (m, 1H), 2.30-1.17 (m, 19H), 0.82 (s, 3H), 0.48 (s, 3H). 88 461.6 white powder 99 462.2 5.65 (s, 1H (C7)), 5.02 (s, 1H), 4.58 (s, 1H), 4.46 (s, 1H), 4.42-4.39 (m, 1H), 3.77 (s, 1H), 3.68-3.55 (m, 1H), 3.48-3.33 (m, 1H), 3.31-3.17 (m, 2H), 3.08-2.95 (m, 1H), 2.70-2.56 (m, 2H), 2.3- 1.18 (m, 20H), 0.82 (s, 3H), 0.47 (s, 3H). 89 489.7 colorless oil 99 490.3 5.65 (s, 1H (C7)), 5.01 (s, 1H), 4.48-4.30 (m, 3H), 3.77 (s, 1H), 3.68-3.55 (m, 1H), 3.45- 3.35 (m, 2H), 3.28-3.11 (m, 2H), 3.08-2.95 (m, 1H), 2.85-2.58 (m, 2H), 2.281.03 (m, 23H), 0.82 (s, 3H), 0.47 (s, 3H). 90 459.6 colorless oil 99 460.3 5.64 (s, 1H (C7)), 5.01 (s, 1H), 4.49-4.38 (m, 2H), 3.77 (s, 1H), 3.68-3.55 (m, 1H), 3.25- 3.20 (m, 1H), 3.10-2.85 (m, 2H), 2.77-2.61 (m, 2H), 2.25-1.03 (m, 21H), 0.88 (d, 3H), 0.82 (s, 3H), 0.47 (m.p. s, 3H). 91 476.7 yellow powder 99 477.3 5.66 (s, 1H (C7)), 5.10 (s, 1H), 4.55-4.40 (m, 2H), 3.77 (s, 1H), 3.68-3.55 (m, 1H), 3.22 ( t, 2H), 3.15-2.93 (m, 3H), 2.75 (s, 6H), 2.35-1.20 (m, 21H), 0.83 (s, 3H), 0.51 (s, 3H). 92 480.6 white powder 99 481.1 5.65 (s, 1H (C7)), 5.06 (s, 1H), 4.46 (d, 1H), 4.41-4.38 (m, 1H), 4.08 (q, 2H), 3.77 (s, 1H), 3.68-3.51 (m, 3H), 3.32 (s, 2H), 3.08-2.90 (m, 1H), 2.28-1.25 (m, 14H), 1.19 (t, 3H), 0.82 (s, 3H); , 0.49 (s, 3H). 93 422.6 white powder 99 423.1 5.65 (s, 1H (C7)), 5.06 (s, 1H), 4.46 (d, 1H), 4.41-4.38 (m, 1H), 3.77 (s, 1H), 3.68-3.51 ( m, 1H), 3.50-3.36 (m, 2H), 3.08-2.90 (m, 1H), 2.48-2.40 (m, 2H), 2.28-1.20 (m, 14H), 1.14 (t, 3H), 0.82 ( s, 3H), 0.51 (s, 3H). 94 438.6 white powder 99 439.2 5.65 (s, 1H (C7)), 5.05 (s, 1H), 4.81 (t, 1H), 4.46 (d, 1H), 4.41-4.38 (m, 1H), 3.77 (s, 1H), 3.68-3.55 (m, 1H), 3.52-3.40 (m, 4H), 3.08-2.90 (m, 1H), 2.58-2.50 (m, 2H), 2.23-1.20 (m, 14H), 0.82 (m, 1H), s, 3H), 0.50 (s, 3H). LCMS purity, UV at 254 nm. Example 8: Scheme H; Preparation of Derivative No. 95: (25,3R, 5R, 10R, 13R, 145,175) -1742-ethoxyacetyl) -2,3,14-trihydroxy-10,13-dimethyl-Z3,4,5,9,11, 12,15,16,17-Decahydro-1H-cyclopentakdphenanthren-6-one Product 102 Product 95 HO HO 100 mg (0.227 mmol) 2S, 3R, 5R, 10R, 13R, 14S, 17S) -17 - (2-bromoacetyl) -2,3,14-thhydroxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one prepared in step 1 of Example 7 are solubilized in 2 mL of ethanol and 0.102 mL (0.272 mmol) of a solution of 21% ethoxide of sodium in ethanol diluted in 1 1 ml of ethanol are added dropwise and the resulting solution is refluxed for 30 minutes. The reaction medium is cooled to 20 ° C. and poured into 25 ml of water and extracted with twice 20 ml of butanol. The organic phase is evaporated to give 30 mg of a purified oil by flash chromatography on silica gel cartridge (dichloromethane / MeOH, 95/5) to give 13.5 mg (yield: 14%) of derivative 95: (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (2-ethoxyacetyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,11, 12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one as a yellow oil. LC-MS: m / z = 407.2 (MEI +) UV purity at 254 nm = 93%. 1H NMR (300MHz, DMSO-d6) 5.65-5.59 (m, 1H (C7)), 4.96 (s, 1H), 4.46 (d, 1H), 4.41-4.36 (m, 1H), 4.03 (q, 2H), 3.77 (s, 1H), 3.68-3.55 (m, 1H), 3.082.90 (m, 1H), 2.75-2.62 (m, 1H), 2.3-2.15 (m, 2H), 1.92-1.42 (m, 1H), m, 13H), 1.18 (t, 3H), 0.83 (s, 3H), 0.58-0.49 (m, 3H). Derivative No. 96 was prepared according to the same scheme. No. PM g / mol Appearance, MS MS m / z 1F1 NMR (300 MHz, DMSO-d6) 8 MH purities (%) 96 448.6 White powder 99 449.1 5.61 (s, 1H (C7)), 5.23-5.15 (m , 1H), 4.97 (s, 1H), 4.48-4.42 (m, 1H), 4.39-4.35 (m, 1H), 3.82-3.55 (m, 6H), 3.08-2.90 (m, 1H), 2.72-2.55 (m, 1H), 2.32-1.17 (m, 17H), 0.83 (s, 3H), 0.58 (s, 3H). 1 LCMS purity, UV at 254 nm. Example 9: Scheme I; Preparation of Derivative No. 97: (25,3R, 5R, 10R, 13R, 145,175) -2,3,14-trihydroxy-1741-hydroxy-2- (2-hydroxyethyl (methyl) amino) ethyl-10,13- dimethy1,2,3,4,5,9,11,12,15,16,17- Decahydro-1H-cyclopenta (cdphenanthrene-6-one) 302 1 3 1 8 68 foH N HO HO O product 87 fOH 157 mg (0.360 mmol) of (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-17- [2- (2-hydroxyethyl (methyl) amino) acetyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one obtained according to the method of step 2 of Example 7 are solubilized in 7.5 ml of ethanol and 21.14 mg (0.559 mmol) of sodium borohydride are added portionwise After stirring for 16 hours at 20 ° C., the reaction medium is poured over 20 ml of sodium borohydride. The organic phase was evaporated to give a purified powder by flash chromatography on silica gel cartridge (dichloromethane / MeOH / NH 4 OH, 85/14/1) to give 96 ml of water and extracted with three times 15 ml of butanol. mg (Yield 60%) of Compound No. 97: (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-17- [1-hydroxy-2- (2-hydroxyethyl) methyl) amino) ethyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one in powder form white. LC-MS: m / z = 438.2 (MH +) UV purity at 254 nm = 99%. 1H NMR (300 MHz, DMSO-d6) δ 5.6 (s, 1H (C7)), 5.32-5.2 (m, 2H), 4.77 (s, 1H), 4.47 (d, 1H), 4.42-4.38 (m, 1H), 3.92-3.57 (m, 4H), 3.3-2.95 (m, 4H), 2.82 (s, 3H), 2.31-1.18 (m, 16H), 0.85 (s, 3H), 0.69 (s, 3H); ). 13 C NMR (75 MHz, DMSO-d 6) b 203.2, 164.9, 121.0, 82.8, 66.9, 59.0, 55.6, 50.6, 46.9, 40.7, 37, 34, 31.9, 31.1, 30.3, 24.5, 23.2, 20.4, 16.3. Derivatives Nos. 98 to 100 were prepared according to the same scheme. No. PM g / mol Apparent E purity (%) MS m / z MH + NMR H (300 MHz, DMSO-d) 6 6 98 440.6 white powder 99 441.1 5.6 (s, 1H (C7)), 4.76 ( t, 1H), 4.65 (s, 1H), 4.47 (d, 1H), 4.43 (d, 1H), 4.36-4.33 (m, 1H), 3.76 (s, 1H), 3.82-3.55 (m, 1H). , 3.53-3.45 (m, 3H), 3.08-2.90 (m, 1H), 2.65-2.55 (m, 3H), 2.45-1.10 (m, 15H), 0.84 (s, 3H), 0.63 (s, 3H). . 99 491.66 white powder 99 492.2 5.61 (s, 1H (C7)), 4.70-4.62 (m, 1H), 4.48-4.28 (m, 3H), 3.76 (s, 1H), 3.65-3.55 (m, 1H), 3.53-3.31 (m, 3H), 3.03-2.84 (m, 2H), 2.78-2.65 (m, 1H), 2.25-1.04 (m, 26H), 0.84 (s, 3H), 0.70-0.55 (m, 3H); ). 100 449.58 orange oil 98 450.2 (in DMSO + D20) 5.65-5.58 (m, 1H (C7)), 4.23-4.13 (m, 1H), 3.75 (s, 1H), 3.04-2.93 (m, 1H), 2.87-2.65 (m, 2H), 2.25-1.10 (m, 22H), 0.83 (s, 3H), 0.63 (m, 3H). 1 LCMS UV purity at 254 nm Example 10: Scheme J; Preparation of Derivative No. 101: (25,3R, 5R, 6E, 10R, 13R, 145,175) -6-methoxyimino-17- (N-methoxy-C (morpholinomethyl) carbonimidoyl) -10,13-dimethyl-2, 3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopentakdphenanthrene-2,3,14-triol <NJ (C) OH N-0 Product 101 HO HO HO HO Product 81 10 30 pl (0.301 mmol) of methoxylamine hydrochloride are solubilized in 0.6 mL of pyridine and 136 mg (0.301 mmol) of (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10 13-dimethyl 17- (2-morpholinoacetyl) -2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one prepared in step 2 of Example 7 are added portionwise After stirring for 36 h at 20 ° C., the reaction medium is taken up in 10 mL of dichloromethane and this solution is washed twice with salt water, dried over sodium sulphate and filtered. and evaporated to give purified powder by flash chromatography on silica gel cartridge (90/10 dichloromethane / MeOH) to give 81 mg (Yield: 53%) of compound no. 101: (2S, 3R, 5R, 6E, 10R, 13R, 14S, 17S) -6-methuyimin-17- (N-methoxy-C- (morpholinomethyl) carbonimidoyl) -10,13-dimethyl- 2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-2,3,14-triol as a yellow powder.
[0037] LC-MS: m / z = 506.2 (MEI +) UV purity at 254 nm = 99%. 1 H NMR (300 MHz, DMSO-d 6) Mixture of (Z) and (E) -formers at C6: 6.28 (s, 0.45 H (C7-E-conformation), 5.72 (s, 0.55H (C7-Z-conformer), 4.62 (s, 0.45H-conformer E), 4.53 (s, 0.55H-Z-conformer), 4.47-4.35 (m, 1H), 4.334.21 (m, 1H), 3.77-3.70 (m, 7H), 3.60-3.48 (m, 5H), 3.16-3.06 (m, 1H), 2.90- 2.70 (m, 2H), 2.45-1.20 (m, 18H), 0.72 (s, 3H), 0.64-0.57 (m, 3H). SCREENING CASCADE AND CHARACTERIZATION OF THE BIOLOGICAL EFFECTS OF 20-HYDROXYECDYSONE DERIVATIVES The development of the screening test was initiated from the literature and based on the characteristics of the pathology of sarcopenia. disease is characterized by a decrease in protein synthesis and an increase in proteolysis.The development of future drugs must therefore be screened for molecular factors related to these two phenomena.At the cellular level, on muscle cell cultures from the line murine C2C12, Gorelick-Feldman showed that treatment with phytoecdysones increases protein synthesis by + 20% on average [Gorelick-Feldman et al., 2008]. The first development studies were based on the culture and treatment conditions described by Gorelick-Feldman in the presence of reference products (IGF-1 and 20-hydroxyecdysone or 20E). Measurements of tritiated leucine incorporation into these cells were performed to evaluate de novo synthesis of proteins. These first results made it possible to determine that the optimal sequence for observing the effects of phytoecdysones on protein synthesis was to differentiate the cells for 5 days, then to put tritiated leucine for 2h30 in the presence of IGF-1 or 20E.
[0038] The literature review showed that molecules such as IGF-1 increased protein synthesis by only 20%, while activating targets of this signaling pathway more sustainably and able to reach stimulations of the order of 20%. 200% [Kazi et al., 2010]. These targets include the activating phosphorylations of proteins such as Akt or S6 kinase. On the other hand, in the same C2C12 cell system, Zubeldia et al. (2012) analyzed the phenomena of apoptosis and proteolysis. In their study, they notably reported that plant extracts containing phytoecdysones such as turkesterone or 20E were able, after 24 hours of treatment of differentiated C2C12 cells, to inhibit the expression of myostatin and caspase genes. 3 by a factor of 4 and 2 respectively [Zubeldia et al., 2012]. After several experiments in which C2C12 cells differentiated into myotubes were incubated in the presence of IGF-1 or 20E for 2.5 hours or 6 hours, two screening tests were developed. Thus, phosphorylation of the protein S6 kinase and expression of the myostatin gene have been studied to determine their modulation by growth hormone or ecdysone and to characterize these modulations from a statistical point of view.25 PROTOCOLS Inhibition Expression of Myostatin in C2C12 Cells C2C12 Myoblastic Cells (ATCC CRL-1772) are inoculated into 24-well plates at the density of 30,000 cells per well and cultured in DMEM medium containing glucose at 4.5 g / L and supplemented with fetal calf serum (10%) and antibiotics (penicillin and streptomycin). Forty-eight hours later, the myoblasts are differentially induced by partial deprivation in serum (2% instead of 10%) for 5 days. The cells are then placed in a glucose-depleted medium (DMEM containing 1 g / L of glucose) and devoid of serum in the presence of the test molecules or references (IGF-1 100 ng / mL or 20E 1011M) for 6 h. At the end of the experiment, messenger RNAs (mRNAs) are extracted using conventional phenol and chloroform methodology. Briefly, the cells are lysed in a solution of trizol (Sigma T9424) containing a strong acid and phenol. The mRNAs are separated from the proteins by addition of chloroform followed by centrifugation. They are then precipitated in isopropanol and then suspended at the concentration of 1 .mu.g / .mu.l in ultra pure water freed of RNases and DNAses. 1 μg of mRNA is then converted by retro-transcription into complementary DNA by the AMV enzyme in the presence of a primer and a mixture of nucleotides according to the protocol given by the supplier (Applied Biosystems 4368814). Gene expression is studied by chain reaction initiated by a polymerase enzyme and commonly called PCR under quantitative conditions, hence the precise name of qPCR. QPCRs are performed on a 7900HT Fast Real-Time PCR detection system (Applied Biosystems). The programming conditions are standard and consist of 1 cycle at 95 ° C for 15 min, followed by 40 cycles at 95 ° C for 15 s and 60 ° C for 1 min and ended with a melt curve step of 60 ° C and 95 ° C. The analyzed samples each contain 100 ng of cDNA, a qPCR buffer including the enzyme, the oligonucleotide mixture and the intercalant (the sybergreen), and the pair of specific primers of the studied gene, strategically chosen between two sequences. exonates and at the final concentration of 200 nM. Fluorescent probes bind to the double-stranded DNA and fluoresce only once attached to the DNA. A fluorescence threshold is established by the program of the machine. When the amount of DNA allows the fluorescent probe to exceed this threshold, we obtain a PCR cycle number called "Cr for" Cycle Threshold "or threshold cycle.It is this value that is the basis of calculations to quantify Relative DNA A R-ratio is established between the amount of DNA starting from a sample and that of a control, which has not been treated (ie R = 2- (Ct sample - control Ct )) and this measurement will be related to that of a household gene known not to be modulated by the treatment (ie R = 2-3.3.ct) The primers used are recorded in the following table: Table 3: Primers used for evaluate gene expression modifications Gene Sequence 5 '3' Nb of bases Tm Accession number mr myostatin d GAGTCTGACTTTCTAATGCAAG 21 62 m: NM_010834 r: AF019624 mr myostatin ind TGTTGTAGGAGTCTTGACGG 20 60 mh Atrogin d AGAGTCGGCAAGTCTGTGCT 62 m: AF441120 h: NM_058229 mh Atrogin ind GTGAGGCCTTTGAAGGCAG 19 60m beta-actin EXAMPLE 6: Phosphorylation of S6 kinase C2C12 myoblast cells (ATCC CRL-1772) are seeded in 6-well plates at a density of 170,000 cells per well and cultured in medium. DMEM containing glucose at 4.5 g / L and supplemented with fetal calf serum (10%) and antibiotics (penicillin and streptomycin). Forty-eight hours later, the myoblasts are differentially induced by partial deprivation in serum (2% instead of 10%) for 5 days. The cells are then placed in a glucose-depleted medium (DMEM containing 1 g / L of glucose) and devoid of serum in the presence of the test molecules or references (IGF-1 100 ng / mL or 20E 1011M) for 2 h. At the end of the experiment, the cells are lysed in commercial lysis buffer (Invitrogen FNN0011) supplemented with a commercial mixture of anti-proteases (Roche 05056489001). After centrifugation, the cytoplasmic fraction containing the soluble proteins is kept and the protein concentration is determined using a commercial kit (Biorad 500-0114), the principle of which is derived from the Lowry assay. S6 kinase phosphorylation assay is performed using a commercial Enzyme Linked ImmunoSorbent Assay kit (Cell signaling 7063). Briefly, 50 μg of protein lysate is placed in the well of a 96-well microplate and incubated overnight at 4 ° C. with the antigen-specific solution of threonine 388 antibody pS6 kinase. the bottom of the wells is done electrostatically. Then incubated at 37 ° C in the wells, the antibody solution to be assayed (pS6K T389) for 2 hours. Antibodies bind specifically to the antigen. The wells are then washed to remove with the washing buffer the primary antibodies specific for the antigen to be assayed which are in excess. The third step is to fix the detection antibody. Incubation at 37 ° C in the wells, detection antibody solution for 1 hour. Wells are then washed to remove excess detection antibodies. It should be noted that the detection antibodies are coupled to an enzyme which, in the presence of its substrate, converts it into a detectable and measurable reaction product by virtue of the appearance of a coloration. The last step is to reveal the fixed antibodies. A developer solution containing the substrate for the enzyme, in this case TMB (3,3 ', 5,5'-tetramethylbenzidine) is incubated at 37 ° C and in the dark for 30 minutes. The appearance of a blue color in the substrate indicates the presence of the antibody to be assayed.
[0039] To avoid any saturation phenomenon, a stop solution (usually containing sodium hydroxide) is added and causes a color change, which becomes blue. The intensity of this is proportional to the amount of enzyme present and therefore the desired antibody concentration. The intensity of the signal is measured by spectrophotometry at the wavelength of 450 nm. 5 R ES U LTATS - The effects on the expression of myostatin (Table 4). Table 4: Effects on the expression of myostatin. The results are expressed as percent gene expression of myostatin in the cells in contact with the molecules related to expression in the control cells. A represents a percentage between 25% and 70%, B represents a percentage between 71% and 85%. Gene expression number Myostatin Gene expression number Myostatin Gene expression number Myostatin 4 A 33 A 65 A 5 A 35 B 67 A 7 A 36 B 68 A 8 B 37 B 71 A 10 A 38 A 73 B 11 B 41 A 75 A 13 B 43 to 76 to 15 to 46 to 79 to 19 to 47 to 81 to 20 to 48 to 83 to 21 to 51 to 85 to 22 to 52 to 86 to 23 to 53 to 88 to 25 to 54 to 89 to 26 to 56 91 B 27 A 57 B 92 A 28 A 60 B 93 A 29 A 62 A 94 A 30 A 63 A 99 A 31 A 64 A 101 A 32 A - Effects on protein synthesis via phosphorylation of S6K1. Table 5: Effects on protein synthesis. The results are expressed as a percentage increase in S6K phosphorylation in muscle cells. A represents values greater than 130% B of values between 110 and 129% Number Protein synthesis Number Protein synthesis A 76 BB 88 BB 89 A 28 A 91 B 46 B 93 A 51 B 81 B 62 A 86 A 41 B 94 A 42 A 67 A Some of the 20E derivatives shown in this table stimulate phosphorylation of S6K1 at levels equivalent to that of 20E (120%) or IGF-1 (120-140%). BIBLIOGRAPHY Arounleut P, Bialek P, Liang LF, et al. 2013. A myostatin inhibitor (propeptide-Fc) inreases muscle mass and muscle fiber size in aged mice but does not increase bone density or bone strength. Exper Gerontol 48: 898-904. Aubertin-Leheudre M, Lord C, Khalil A, Dionne IJ. 2007. Six months of isoflavone supplement increases fat-free mass in obese-sarcopenic postmenopausal women: a randomized double-blind controlled trial. Eur J Clin Nutr 61: 1442-1444. Aussel C, Woelffle E, Lemoigne P, Depailler L, Bouillanne 0. 2013. A new nutritional strategy to fight against undernutrition and sarcopenia: the pulsed protein diet. Dietary Nutrition Notebooks 48: 33-40. Azizov AP, Seifulla RD, Ankudinova IA, Kondrat'eva II, Borisova IG. 1998.
[0040] Effect of the antioxidants elton and leveton on the physical work capacity of athletes. Eksp Klin Farmakol 61 (1): 60-62. Baptista IL, Leal ML, Artioli GG, et al. 2010. Leucine attenuates skeletal muscle wasting via inhibition of ubiquitin ligases. Muscle Nerve 41 (6): 800808.
[0041] Bennett BT, Mohamed JS, Alway SE. 2013. Effects of resveratrol on the recovery of muscle mass following disuse in the plantaris muscle of aged rats. PLoS One 8 (12): e83518. Boirie Y, Gachon P., Beaufrère B. 1997. Splanchnic and whole body leucine kinetics in young and elderly men. Am J Clin Nutr. 65: 489-495.
[0042] Bonnefoy M, Constans T, Ferry M. 2000. Undernutrition of the elderly. Influence of nutrition and physical activity on the muscle in old age. Press Med 29: 2177-2182. Bonnefoy M. 2008. Interventions to restore muscle mass in the elderly. Nutr Clin Metab 22: 80-83.
[0043] Buehring B, Binkley N. 2013. Myostatin - the holy grail for muscle, bone, and fat Curr Osteoporos Rep 11 (4): 407-414. Castan-laurell I, Dray C, Knauf C, Kunduzova O, Valet P. 2012. Apelin, a promising target for type 2 diabetes treatment Trends Endocrinol Metab 23 (5): 234-241.
[0044] Chermnykh NS, Shimanovsky NL, Shutko GV, Syrov VN. 1988. Effects of methandrostenolone and ecdysterone on the physical endurance of animals and protein metabolism in the skeletal muscles. Farmakologiya i Toksikologiya 6: 57-62. Clerk M, Petit A, Déchelotte P. 2009. Which pharmaconutrition to fight 40 against sarcopenia Clinical Nutrition Metabolism 23: 76-79.
[0045] Collins-Hooper H, Sartori R, Macharia R, et al. 2014. Propeptide-mediated inhibition of myostatin increases muscle mass through inhibiting proteolytic pathways in aged mice. J Gerontol to Biot Sci Med Sci, doi: 10.1093 / gerona / gh170.
[0046] Crenn P. 2013. Sarcopenia and cachexia: a drug approach. Clinical Nutrition Metabolism 27: 69-73. of N Jager, Hudson NJ, Reverter A, et al. 2011. Chronic exposure to anabolic steroids induces the muscle expression of oxytocin and a more than fiftyfold increase in circulating oxytocin in cattle. Physiol Genomics 43: 46710 478. Dumonceaux J, Marie S, Beley C, Trollet C, Vignaud A, Ferry A, ButlerBrowne G, Garcia L. 2010. Combination of myostatin pathway interference and dystrophin rescue enhances tetanus and specific strength in dystrophic mice . Mol Ther 18 (5): 881-887. 15 Fiatarone MA, EC Marks, Ryan ND, CN Meredith, Lipsitz LA, Evans WJ. 1990. High-intensity strength training in nonagerians. JAMA 263: 3029-3034. Foucault AS, Mathé V, Lafont R, Even P, Dioh W, Veillet S, Tomé D, D Huneau, Hermier D, Quignard-Boulangé A. 2012. Quinoa extract enriched in 20-hydroxyecdysone protects mice from diet-induced obesity and modulates Adipokines expression. Obesity 20: 270-277. Foucault AS, Dioh W, Lafont R, Veillet S, Tomé D, Quignard-Boulangé A 'Clément K, Rizkalla S. 2014. 20-Hydroxyecdysone increases android fat mass loss with no significant effect on muscle mass loss during a weight loss program obese and overweight subjects. ICFSR 2014 International 25 Conference of Frailty and Sarcopenia Research, Barcelona, 12-14 / 03/2014. Gadzhieva RM, Portugalov SN, Paniushkin VV, Kondrat'eva II. 1995. A Comparative Study of the Anabolic Action of Ecdysten, Leveton and Prime Plus, preparations of plant origin. Eksp Klin Farmakologiya 58 (5): 46-48. Gilson H, Schakman O, Combaret L, et al. 2007. Myostatin gene deletion 30 prevents glucocorticoid-induced muscle atrophy. Endocrinology 148: 452-460. Gorelick-Feldman J, MacLean D, Hic N, Poulev A, MA Lila, Raskin I. 2008. Phytoecdysteroids increase protein synthesis in skeletal muscle cells. J. Agric. Food Chem. 56: 3532-3537. Gorelick-Feldman J, Cohick W, Raskin I. 2010. Ecdysteroids elicit a rapid 35 Ca2 + flux leading to activation and increased protein synthesis in skeletal muscle cells. Steroids 70: 632-637. Greenberg SA. 2012. Pathogenesis and therapy of inclusion body myositis. Curr Opin Neurol 25 (5): 630-639. Han HQ, Mitch WE. 2011. Targeting the myostatin signaling pathway to treat 40 muscle wasting diseases. Curr Opin Support Palliat Care 5 (4): 334-341.
[0047] Hung TJ, Chen WM, Liu SF, et al. 2012. 20-Hydroxyecdysone attenuates TGF-I31-induced renal cellular fibrosis in proximal tubule cells. J Diabetes Complications 26 (6): 463-469. Kazi AA, Lang CH 2010. PRAS40 Regulates Protein Synthesis and Cell Cycle in C2C12 Myoblasts Mol Med.16 (9-10): 359-371. Kizelsztein P, Govorko D, Komarnytsky S, Evans A, Wang Z, Cefalu WT, Raskin I. 2009. 20-Hydroxyecdysone decreases weight and hyperglycemia in a diet-induced obesity mice model. Am. J. Physiol. Endocrinol. Metab. 296: E433-E439. Lafont R, Clement K, Rizkalla S, Foucault AS, Veillet S, Dioh W. 2013 Phytoecdysones for use in weight stabilization after a weight loss diet. PCT patent application WO 2013/068704 Larock RC. 1989. Comprehensive organic transformations: A guide to functional group preparations. VCH Publishers, New York. 15 Lawrence MM. 2012. Ajuga turkestanica as a countermeasure against sarcopenia and dynapenia. Ms Thesis, Appalachian State University. Light B, Derave W, De Bock K; Hespel P, Russell AP. 2008. Human sarcopenia increased in SOCS-3 and myostatin and reduced efficiency of phosphorylation. Rejuvenation Res 11 (1): 163-175. 20 Li Z, Heber D. 2011. Sarcopenic obesity in the elderly and strategies for weight management. Nutrition Reviews 70 (1): 57-64. Li ZB, Kollias HD, Wagner KR. 2008. Myostatin directly regulates skeletal muscle fibrosis. J. Biol. Chem. 283 (28): 19371-19378. Little JP, Phillips SM. 2009. Resistance exercise and nutrition to counteract 25 muscle wasting. Appl Physiol Nutr Metab 34: 817-828. Liu W, Thomas SG, Asa SL, et al. 2003. Myostatin is a skeletal muscle target of growth hormone anabolic action. J Clin Endocr Metab 88 (11): 5490-5496. Macell TJ, Harman SM, Urban RJ, et al. 2001. Comparison of GH, IGF-I, and testosterone with mRNA of receptors and myostatin in skeletal muscle in 30 older men. Am J Physiol Endocrinol Metab 281: E1159-E1164. Murad MH, Elamin KB, Abu Elnour NO, et al. 2011. Clinical review: the effect of vitamin D on falls: a systematic review and meta-analysis. J Clin Endocrinol Metab 96 (10): 2997-3006. Murphy KT, Koopman R, Naim T, et al. 2010. Antibody-directed myostatin 35 inhibition in 21-mo-old mice reveals new roles for myostatin signaling in skeletal muscle structure and function. FASEB J 24: 4433-4442. Pierno S, Tricarico D, Liantonio A, et al. 2014. AN olive oil-derived antioxidant mixture ameliorates the age-related decline of skeletal muscle function. AGE 36: 73-88.
[0048] Quillot D, Biihme P, Malgras P, Malgras A, Ziegler 0. 2013. Obesity of the elderly subject. Nutr Clin Metabolism 27: 95-101. Ryall JG, DR Plant, Gregorevic P, Silence MN, Lynch GS. 2004.132-Agonist administration reverses muscle wasting and improving muscle function in aged rats. J Physiol 555 (1): 175-188. Ryall JG, JE Church, Lynch GS. 2007. A novel rote of 13-adrenoceptor signaling in skeletal muscle growth, development and regeneration. Proc Australian Physiol Soc 40: 103-108. Ryan AS, Li G, Blumenthal JB, Ortmeyer HK. 2013. Aerobic exercise + 10 weight loss decreases skeletal myostatin muscle expression and improved insulin sensitivity in older adults. Obesity 21 (7): 1350-1356. Saini A, Faulkner S, AL-Shanti N, Stewart C. 2009. Powerful signais for weak muscles. Ageing Res Rev 8: 251-267. Sakuma K, Yamaguchi A. 2012. Sarcopenia and age-related endocrine function. Int J Endocrinol, doi: 10.1155 / 2012/127362. Sattler FR. 2013. Growth hormone in the aging male. Best Practice Res Clin Endocr Metab 27: 541-555. Schaap LA, Pluijm SMF, Deeg DJH, et al. 2009. Higher inflammatory marker levels in older persons: associations with 5-year change in muscle mass and 20 muscle strength. J Gerontol A Sci Biol Sci Sci 64A (11): 1183-1189. Seidlova-Wuttke D, Erhardt C, Wuttke W. 2010. Metabolic effects of 20-OH ecdysone in ovariectomized rats. J Steroid Biochem Mol Biol 119: 121-126. Seidman SN. 2007. Androgens and the aging male. Psychopharmacol Bull 40: 205-218. Shadfar S, Couch ME, McKinney KA, et al. 2011. Oral resveratrol therapy cancer-induced inhibitors skeletal muscle and cardiac atrophy in vivo. Nutr Cancer 63 (5): 749-762. Simakin SYu, Panyushkin VV, Portugalov SN, Kostina LV, Martisorov EG. 1988. Combined application of preparation Ecdysten and product Bodrost 30 during training in cyclic sports. Sports Science Bulletin No. 2, 29-31. Stenholm S, Alley D, Bandinelli S, et al. 2009. The effect of obesity combined with low muscle strength in the inpatient population: results from the InCHIANTI study. Int J Obesity 33: 635-644. Syrov VN. Comparative experimental investigations of the anabolic activity of ecdysteroids and steranabols. Pharm Chem Journal 34 (4): 193197. Tchoukouegno Ngueu S. 2013. Estrogenic, cytotoxic and anabolic effects on estrogen target of an extract of Erythrina excelsa and ecdysterone. PhD thesis, German Sports University of Cologne.
[0049] Tisdale MJ. 2001. Lipolytic and proteolytic factors of cancer cachexia. Nutr Clin Metabol 15: 266-272. Todorov IN, Mitrokhin Yul, Efremova 01, Sidorenko LI. 2000. The effect of ecdysterone on the biosynthesis of proteins and nucleic acids in mice.
[0050] Chem. Chem. 34 (9): 455-458. Toth N, Szabb A, Kacsala P, Heger J, Zador E. 2008. 20-Hydroxyecdysone increases fiber size in a muscle-specific fashion in rat. Phytomedicine 15: 691-698. Verghese J, Holtzer R, Oh-Park M, et al. 2011. Inflammatory markers and 10 gait speed decline in older adults. J Gerontol A Biot Sci Med Sci 66A: 10831089. Walston JD. 2012. Sarcopenia in older adults. Curr. Rheumatol opinion. 24: 623-627. White JP, Gao S, Puppa MJ, et al. 2013. Testosterone regulation of 15 Akt / mTORC1 / Fox03a signaling in skeletal muscle. Mol Cell Endocrinol 365: 174-186. White TA, LeBrasseur, NK. 2014. Myostatin and sarcopenia: opportunities and challenges - a mini-review. Gerontology, doi: 10.1159 / 000356740. Wuttke W, Seidlovà-Wuttke D. 2013. Pflanzliche Práparate für die Therapie 20 klimaterischer und postmenopausaler Beschwerden und Erkrankungen. Frauenartz 54: 580-587. Zhao J, Brault JJ, Schild A, Goldberg AL. 2008. Coordinate activation of autophagy and the proteasome pathway by Fox0 transcription factor. Autophagy 4 (3): 378-380.
[0051] 25 Zhu WM, Zhu HJ, Tian WS, Hao XJ, Pittman Jr CU. 2002. The selective dehydroxylation of 20-hydroxyecdysone by Zn powder and anhydrous acetic acid. Synthetic Communications 32: 1385-1391. Zubeldia JM, Hernandez-Santana A, Jimenez-de-Rio M, et al. 2012. In vitro characterization of the efficacy and safety profile of a proprietary Ajuga 30 turkestanica extract. Chinese Medicine 3: 215-222.

权利要求:
Claims (10)
[0001]
REVENDICATIONS1. Compounds of the following general formula (I): Q-R1 (I) wherein: X is selected from: oxygen; an N-OR5 group, R5 then being chosen from: a hydrogen; a C1-C6 alkyl group with or without unsaturations on the chain; a group (C1-C6) CO2R8 with R6 may be a hydrogen or a group Ci-C6; a group (C 1 -C 6) OR 7, R 7 being an aromatic or heteroaromatic ring mono or polysubstituted or not by an alkyl or alkoxyl group, CF 3, Cl; a group (C1-C6) NR8R9, and R9 being C1-C6 groups, or (C1-C6) N (C1-C6) groups or (C1-C6) N (C1-C6) OR8 groups with R6 defined as above, NR8R9 may also be a heterocycle; and wherein: - R1 is selected from: a C1-C6 alkyl group; a group (C 1 -C 6) W (C 1 -C 6); a group (Ci-C6) W (C1C6) W (C1-C6); a group (C1-C6) W (C1-C6) CO2 (C1-C6); a (C 1 -C 6) A group, A representing a heterocycle optionally substituted by a group of OH, OMe, (C 1 -C 6), N (C 1 -C 6), CO2 (C 1 -C 6); with V-U being a carbon-carbon single bond and Y being a hydroxyl group or a hydrogen, or V-U being a Cyl C ethylenic bond; and with Q selected from: a carbonyl group; a group of CHO (C1-C6) type; a group C = NOR5, R5 being defined as above; a group CHNR 2 R 3, R 2 and R 3 being chosen from: a hydrogen atom; a (C1-C6) alkyl group; a group (C1-C6) W (C1C6); a cycloalkyl group; a group (Ci-C6) CHF2; a group (C1-C6) A with A representing a heterocycle defined as above; a group of COR4 type, R4 being chosen from: an optionally unsaturated (Ci-C6) alkyl or cycloalkyl group; a heterocyclic group of type A as defined above, an aromatic or heteroaromatic group optionally substituted with a group of OH, OMe, (C1-C6), N (C1-C6), CO2 (C1-C6), CF3 or OCF3 type; , CN, Cl, F; a group (C 1 -C 6) W (C 1 -C 6); W being a heteroatom selected from N, O and S; OR, - al is selected from: a (C 1 -C 6) W (C 1 -C 6) group; a group (C1-C6) W (C1-C6) W (C1-C6); a group (C1-C6) W (C1-C6) CO2 (Ci-C6); with Q being a CHOH group; with V-U being a carbon-carbon single bond and Y being a hydroxyl group or a hydrogen, V-U may also be a Cyl C ethylenic bond; W being a heteroatom selected from N and S; or, - R1 is -CH (Me) CH (OH) (CH2) 2C (CH3) 20H; Q is a group C (Me) OH; V-U is an ethylenic bond C = C; excluding post-terone of formula (I '), deoxy-poststerone 14 of formula (I "), stachysterone B of formula (I"') and stachysterone-derivative product B of formula (I ') (I ") the compounds being in the form of an enantiomer, a diastereoisomer, a hydrate, a solvate, a tautomer, a racemic mixture or a pharmaceutically acceptable salt acceptable.
[0002]
Compounds according to claim 1, wherein Q represents a carbonyl group.
[0003]
Compounds according to claim 1, wherein Q represents a group C = NOR5.
[0004]
4. Compounds according to claim 1, wherein Q represents a CHNR2R3 group.
[0005]
Compounds according to claim 1, wherein V-U is a Cyl C ethylenic linkage. 20
[0006]
Compounds according to claim 1, wherein X is an N-OR5 group.
[0007]
7. A compound according to any one of claims 1 to 6, selected from the following compounds: (2R, 3R) -2 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2.3- dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,2,4,5,9,11,12,16,17-decahydrocyclopenta [a] phenanthrene-17-yl] -6-methyl-heptane-2,3 , 6-triol 101 - [(2S, 3R, 5R, 6Z, 10R, 13R, 17S) -2,3-dihydroxy-6-methoxyimino-10,13-dimethyl-1,2,3,4,5,9 11,12,16,17-Decahydrocyclopenta [a] phenanthrene 17-yl] ethanone 1 - [(2S, 3R, 5R, 6Z, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-6-methoxyimino 10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethanone (2S, 3R, 5R, 10R) 13R, 14S, 17S) -17- (N-but-3-enoxy-C-methyl-carbonimidoyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9, 11,12,15,16,17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one 2-methoxy-N- (2-methoxyethyl) -N41 - [(2S, 3R, 5R, 10R, 13R, 14S) 17S) - 2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] acetamide (2S, 3R, 5R, 10R, 13R 14S, 17S) -2,3,14-trihydroxy-17- [1- (2-methoxyethylamino) ethyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16 17-Decahydro-1H-cyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-1741- (tetratetrahydrofuran) 2-ylmethylamino) ethyl] -2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one 2-ethyl-N- (2- methoxyethyl) -N41 - [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9, 11,12,15,16,17-DecahydroH-cyclopenta [a] phenanthrene-17-yl] ethyl] butanamide 2-methoxy-N- (tetratetrahydrofuran-2-ylmethyl) -N- [1- [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-6-oxo 2,3,4,5,9,11,12,15,16,17-decahydro N- (2,2-difluoroethyl) -N11 - [(2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3-H-cyclopenta [a] phenanthrene-17-yl] ethyl] acetamide; 14-Trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17,17-decahydro-1H-cyclopenta [a] phenanthrene-17-yl] ethyl] furan 2-carboxamide (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-1741- (2- Methoxyethyl (methyl) amino) ethyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one (2S , 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-10,13-dimethyl-17- (2-morpholinoacetyl) -2,3,4,5,9,11,12, 15,16,17-Decahydro-1Hcyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-17- [2- (3-hydroxypyrrolidine) 1-yl) acetyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthren-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-17- [2- (4-hydroxy-1-piperidyl) acetyl] -10,13-dimethyl-2,3,4, 5,9,11,12,15,16,17-DecahydroH-cyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy-174214 - (2-hydroxyethyl) -1-piperidyl] acetyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene; 6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- [2- (3-dimethylaminopropyl (methyl) amino) acetyl] -2,3,14-trihydroxy-10,13-dimethyl 2,3,4,5,9,11,12,15,16,17-decahydro-1Hcyclopenta [a] phenanthrene-6- one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -17- (2-ethylsulfanylacetyl) -2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5 , 9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one (2S, 3R, 5R, 10R, 13R, 14S, 17S) -2,3,14-trihydroxy- 1742- (2-hydroxyethylsulfanyl) acetyl] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta [a] phenanthrene-6-one;
[0008]
8. Compounds according to any one of claims 1 to 7 as a medicament.
[0009]
Compounds according to any one of claims 1 to 8, for use in the treatment and / or prevention of sarcopenia and in particular of sarcopenic obesity, its complications and / or associated pathologies such as loss of strength. , muscle mass and mobility.
[0010]
10.Compounds according to any one of claims 1 to 8, for use in the treatment and / or prevention of obesity and its complications and / or associated pathologies, advantageously type 2 diabetes or metabolic syndrome. 10 15 20 25 30

类似技术:

---

公开号 | 公开日 | 专利标题

---

EP3145942B1|2019-04-03|Chemical compounds and use thereof for improving muscular quality

---

JP2019023200A|2019-02-14|2,2-difluoropropionamide derivatives of bardoxolone methyl, and polymorphic forms and methods of use thereof

---

CN108290922B|2021-12-07|C4-modified oleanolic acid derivatives for inhibition of IL-17 and other uses

---

EP1601363B1|2012-06-20|Use of derivatives of cholest-4-en-3-one as medicaments, pharmaceutical compositions containing same, novel derivatives and preparation method thereof

---

TW201006474A|2010-02-16|Natural products including an anti-flammatory pharmacore and methods of use

---

JP2021035949A|2021-03-04|Hydroxysteroid compounds, intermediates thereof, process for preparing the same, composition and use thereof

---

IL276592D0|2020-09-30|Derivatives of sobetirome

---

CN112110978A|2020-12-22|Oleanolic acid saponin compound and medical application thereof

---

FR2940650A1|2010-07-02|NOVEL OXIME DERIVATIVES OF 3,5-SECO-4-NOR-CHOLESTANE, PHARMACEUTICAL COMPOSITIONS COMPRISING THE SAME, AND PROCESS FOR PREPARING THE SAME

---

WO2012056976A1|2012-05-03|Modulator of activity of adenylate cyclase

---

CN112218878A|2021-01-12|NTCP inhibitors

---

JP2015529254A|2015-10-05|Novel GABAA agonists and methods of use for controlling airway hypersensitivity and inflammation in asthma

---

CN109415356B|2022-03-08|Crystalline forms of 4- | -1,2, 4-oxadiazol-3-yl) benzoic acid and methods for their preparation

---

JP2020083811A|2020-06-04|Ampk activator containing 1,5-anhydro fructose derivative

---

JP6727596B1|2020-07-22|Carbalisophosphatidic acid

---

US20210040098A1|2021-02-11|Apelin receptor agonists and methods of use thereof

---

FR3035105A1|2016-10-21|DERIVATIVES USEFUL IN THE TREATMENT OF MUSCLE ATROPHY

---

JP6791977B2|2020-11-25|Frostan-3ol derivative as a skeletal muscle hypertrophy agent

---

KR101196467B1|2012-11-01|Scalarane-based sesterpermens, method of recovering and a medicine containing the same

---

FR2796381A1|2001-01-19|Thiazepin and caprolactam bicyclic derivatives, useful in the treatment of e.g. osteoporosis and other bone disorders, infections, allergies or cancers

---

FR2802927A1|2001-06-29|New 6,10-dioxo-octahydro-6H-pyridazino | | diazepine derivatives, are metabolic enzyme inhibitors useful e.g. for treating cardiovascular or central nervous system disorders or cancer

---

FR2793796A1|2000-11-24|Imidazole derivatives having Src SH2 receptor antagonist activity for the prevention and treatment of osteoporosis, auto-immune diseases, proliferative diseases, cancers, allergies and other disorders

同族专利:

---

公开号 | 公开日

---

US10316056B2|2019-06-11|

---

JP2017516851A|2017-06-22|

---

PL3145942T3|2019-10-31|

---

RU2016149619A|2018-06-20|

---

CN106536539A|2017-03-22|

---

WO2015177469A1|2015-11-26|

---

ES2732460T3|2019-11-22|

---

KR20170027319A|2017-03-09|

---

AU2015263121B2|2018-12-06|

---

CN106536539B|2020-01-07|

---

AU2015263121A1|2017-01-12|

---

JP6621217B2|2019-12-18|

---

RU2724329C2|2020-06-23|

---

CA2949649A1|2015-11-26|

---

BR112016027053A2|2017-08-15|

---

US20170226151A1|2017-08-10|

---

IL249062D0|2017-01-31|

---

EP3461833A1|2019-04-03|

---

TR201909078T4|2019-07-22|

---

EP3145942B1|2019-04-03|

---

PT3145942T|2019-07-04|

---

BR112016027053A8|2021-07-20|

---

RU2016149619A3|2018-11-19|

---

US9938315B2|2018-04-10|

---

EP3145942A1|2017-03-29|

---

FR3021318B1|2017-04-28|

---

US20180327444A1|2018-11-15|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

WO2006007910A1|2004-07-20|2006-01-26|Santhera Pharmaceuticals Ag|Use of non-glucocorticoid steroids for the treatment of muscular dystrophy|

---

WO2009114201A2|2008-03-14|2009-09-17|Intrexon Corporation|Steroidal ligands and their use in gene switch modulation|

---

WO2013068704A1|2011-11-10|2013-05-16|Institut Biophytis Sas|Phytoecdysones for use in weight stabilisation after a weight-loss diet|WO2018197708A1|2017-04-28|2018-11-01|Biophytis|Use of 20-hydroxyecdysone and the derivatives thereof in the treatment of myopathies|

---

WO2019166717A1|2018-02-28|2019-09-06|Biophytis|Phytoecdysones for use in the prevention of muscle strength loss during immobilisation|

---

FR3093640A1|2019-03-15|2020-09-18|Biophytis|Phytoecdysones and their derivatives for their use in the treatment of neuromuscular diseases|

---

FR3093641A1|2019-03-15|2020-09-18|Biophytis|Phytoecdysones and their derivatives for use in the treatment of impaired respiratory function|

---

FR3108504A1|2020-03-30|2021-10-01|Biophytis|Phytoecdysones and their derivatives for use in the treatment of impaired respiratory function during viral infection|

法律状态:
2015-05-29| PLFP| Fee payment|Year of fee payment: 2 |

---

2015-11-27| PLSC| Search report ready|Effective date: 20151127 |

---

2016-03-18| TQ| Partial transmission of property|Owner name: INSTITUT BIOPHYTIS, FR Effective date: 20160208 Owner name: BIOPHYTIS, FR Effective date: 20160208 Owner name: UNIVERSITE PIERRE ET MARIE CURIE, FR Effective date: 20160208 |

---

2016-05-31| PLFP| Fee payment|Year of fee payment: 3 |

---

2016-12-23| CD| Change of name or company name|Owner name: BIOPHYTIS, FR Effective date: 20161123 |

---

2016-12-23| CJ| Change in legal form|Effective date: 20161123 |

---

2017-05-30| PLFP| Fee payment|Year of fee payment: 4 |

---

2017-07-28| CD| Change of name or company name|Owner name: UNIVERSITE PARIS 6 PIERRE ET MARIE CURIE, FR Effective date: 20170622 Owner name: BIOPHYTIS, FR Effective date: 20170622 |

---

2017-07-28| CA| Change of address|Effective date: 20170622 |

---

2018-05-31| PLFP| Fee payment|Year of fee payment: 5 |

---

2019-05-31| PLFP| Fee payment|Year of fee payment: 6 |

---

2020-05-29| PLFP| Fee payment|Year of fee payment: 7 |

---

2021-05-28| PLFP| Fee payment|Year of fee payment: 8 |

优先权:

---

申请号 | 申请日 | 专利标题

---

FR1454538A|FR3021318B1|2014-05-20|2014-05-20|20-HYDROXYECDYSONE-DERIVED PRODUCTS AND THEIR USE IN THE PREPARATION OF MEDICAMENTS|FR1454538A| FR3021318B1|2014-05-20|2014-05-20|20-HYDROXYECDYSONE-DERIVED PRODUCTS AND THEIR USE IN THE PREPARATION OF MEDICAMENTS|

---

JP2017513358A| JP6621217B2|2014-05-20|2015-05-20|Compounds and their use to improve muscle quality|

---

KR1020167035614A| KR20170027319A|2014-05-20|2015-05-20|Chemical compounds and use thereof for improving muscular quality|

---

EP18205305.8A| EP3461833A1|2014-05-20|2015-05-20|Chemical compounds and use thereof for improving muscular quality|

---

PT15732785T| PT3145942T|2014-05-20|2015-05-20|Chemical compounds and use thereof for improving muscular quality|

---

ES15732785T| ES2732460T3|2014-05-20|2015-05-20|Chemical compounds and their use to improve muscle quality|

---

PL15732785T| PL3145942T3|2014-05-20|2015-05-20|Chemical compounds and use thereof for improving muscular quality|

---

RU2016149619A| RU2724329C2|2014-05-20|2015-05-20|Chemical compounds and use thereof to improve quality of muscles|

---

PCT/FR2015/051332| WO2015177469A1|2014-05-20|2015-05-20|Chemical compounds and use thereof for improving muscular quality|

---

AU2015263121A| AU2015263121B2|2014-05-20|2015-05-20|Chemical compounds and use thereof for improving muscular quality|

---

CN201580038427.3A| CN106536539B|2014-05-20|2015-05-20|Compounds for improving muscle mass and uses thereof|

---

EP15732785.9A| EP3145942B1|2014-05-20|2015-05-20|Chemical compounds and use thereof for improving muscular quality|

---

TR2019/09078T| TR201909078T4|2014-05-20|2015-05-20|Chemical compounds and their use for muscle quality improvement.|

---

BR112016027053A| BR112016027053A8|2014-05-20|2015-05-20|compost and uses of a compost|

---

CA2949649A| CA2949649A1|2014-05-20|2015-05-20|Chemical compounds and use thereof for improving muscular quality|

---

US15/311,967| US9938315B2|2014-05-20|2015-05-20|Chemical compounds and use thereof for improving muscular quality|

---

IL249062A| IL249062D0|2014-05-20|2016-11-20|Chemical compounds and use thereof for improving muscular quality|

---

US15/949,010| US10316056B2|2014-05-20|2018-04-09|Chemical compounds and use thereof for improving muscular quality|